ID: 908398306

View in Genome Browser
Species Human (GRCh38)
Location 1:63746396-63746418
Sequence CAGAACAAGGTGGCGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908398297_908398306 18 Left 908398297 1:63746355-63746377 CCTGCATAATGAAATTCAGACAG No data
Right 908398306 1:63746396-63746418 CAGAACAAGGTGGCGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908398306 Original CRISPR CAGAACAAGGTGGCGTGGGC TGG Intergenic
No off target data available for this crispr