ID: 908399378

View in Genome Browser
Species Human (GRCh38)
Location 1:63756071-63756093
Sequence GACTCAGGAGTTTCCTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908399378_908399385 -1 Left 908399378 1:63756071-63756093 CCCTCCCAGGAAACTCCTGAGTC No data
Right 908399385 1:63756093-63756115 CCTGAGCAAGTCAGGATGATTGG No data
908399378_908399388 17 Left 908399378 1:63756071-63756093 CCCTCCCAGGAAACTCCTGAGTC No data
Right 908399388 1:63756111-63756133 ATTGGTCACTCACAATGGGTAGG No data
908399378_908399382 -9 Left 908399378 1:63756071-63756093 CCCTCCCAGGAAACTCCTGAGTC No data
Right 908399382 1:63756085-63756107 TCCTGAGTCCTGAGCAAGTCAGG No data
908399378_908399387 13 Left 908399378 1:63756071-63756093 CCCTCCCAGGAAACTCCTGAGTC No data
Right 908399387 1:63756107-63756129 GATGATTGGTCACTCACAATGGG No data
908399378_908399386 12 Left 908399378 1:63756071-63756093 CCCTCCCAGGAAACTCCTGAGTC No data
Right 908399386 1:63756106-63756128 GGATGATTGGTCACTCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908399378 Original CRISPR GACTCAGGAGTTTCCTGGGA GGG (reversed) Intergenic
No off target data available for this crispr