ID: 908401135

View in Genome Browser
Species Human (GRCh38)
Location 1:63774062-63774084
Sequence CGCCGCCGCCGAGGGAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908401135 Original CRISPR CGCCGCCGCCGAGGGAGCCC CGG Exonic
900164589 1:1239677-1239699 CGACCCAGCCGAGGCAGCCCCGG + Intergenic
900307575 1:2018826-2018848 CGCCCCCGTCGAGGGTCCCCAGG + Intergenic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
901602149 1:10430673-10430695 CGCAGCCGCGGGGGGCGCCCGGG - Intronic
901791365 1:11655043-11655065 CGCAGTTGCCGAGGGAGGCCTGG + Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902481196 1:16712790-16712812 CGCCTCCCCAGAGGGAGGCCAGG + Intergenic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903652332 1:24929796-24929818 CGCCGCCGCAGGGGAAGGCCGGG + Exonic
904039598 1:27576116-27576138 CGCCGCTGCGGAGGGAGCGCCGG - Intronic
905308398 1:37034113-37034135 GGGCGCCGCCGAGCGTGCCCGGG + Exonic
905422629 1:37859138-37859160 CGTTGCCGCCGAGGGTGCCGGGG - Intronic
905734602 1:40316750-40316772 CGCCGCCTCCCAGGGGGCGCCGG - Intronic
906032969 1:42735094-42735116 CGCCTCCGCCAAGGGCCCCCTGG - Exonic
906365422 1:45205978-45206000 CGCCGGCGCCGGGGCCGCCCCGG + Exonic
906627019 1:47333813-47333835 CCCCGCCGCCGTGGCTGCCCGGG - Exonic
906917191 1:50023998-50024020 CGCCCCCGCGGCGCGAGCCCGGG + Intergenic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
908544248 1:65148343-65148365 CGCGGCCCCGGAGGAAGCCCCGG - Exonic
912174683 1:107141229-107141251 CGCCGCCACCGCCGCAGCCCGGG - Intronic
912416226 1:109509742-109509764 CGTCGCCGCCGCCGGAGCCTCGG + Intergenic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
915323829 1:155070448-155070470 CGCCCCCTCCGAGAGAGACCGGG - Intergenic
915666181 1:157446762-157446784 CGCCGCCAAAGTGGGAGCCCAGG + Intergenic
918792110 1:188841656-188841678 CGCCGCCAAAGTGGGAGCCCAGG + Intergenic
920021177 1:202957956-202957978 CGCCGCCTCCGAGGCGGCCTAGG - Intronic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
923141479 1:231163782-231163804 CGCCTCCGCTGGGGGCGCCCTGG - Exonic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1062898100 10:1120364-1120386 CGCCGCCTCCGAGGGGCACCCGG + Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1066233973 10:33467912-33467934 TGCCGCCGAAGTGGGAGCCCAGG - Intergenic
1067669689 10:48307213-48307235 CGCCGCCCCGGAGGCAGCCAGGG - Intronic
1067808150 10:49407480-49407502 CACTGCCTCCGAGGGAGCACAGG + Intergenic
1069521365 10:69124195-69124217 CGCCGGAGCGGAGGGAGCCGGGG + Exonic
1069651601 10:70053436-70053458 CGCAGGGCCCGAGGGAGCCCGGG + Intronic
1070151993 10:73811097-73811119 TGCGGGCGCCGAGGGGGCCCGGG + Intronic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072719507 10:97771944-97771966 CGCCGCCGCGGAGGTCGCCCAGG + Exonic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074591870 10:114821712-114821734 CGCCGCAGCCCGGGGAGGCCCGG - Intergenic
1075519709 10:123136260-123136282 CGCGGCGGCCAAGGGGGCCCTGG + Exonic
1075871276 10:125774029-125774051 CTCCGCCGTCGGGGTAGCCCCGG + Exonic
1076192537 10:128492768-128492790 TGCTGCCTCCGCGGGAGCCCTGG + Intergenic
1076848536 10:133081852-133081874 CGGTGCTGCCGAGGGAGCCCTGG - Intronic
1077038713 11:507766-507788 CGCGACCCCCGAGGGAGCCACGG + Intergenic
1077152476 11:1078467-1078489 GGCCGCCGGCGTGGGAGCACTGG - Intergenic
1077342095 11:2030730-2030752 AGCAGCCGCCTGGGGAGCCCCGG - Intergenic
1077367327 11:2166451-2166473 CGCGGCCTCGGAGGGAGCCGGGG - Intronic
1077922972 11:6655482-6655504 CGCCGCCGCTGCCGCAGCCCAGG + Intronic
1078157377 11:8810558-8810580 CGCAGCCGGCTAGGGAGCCCAGG + Intronic
1079451204 11:20601262-20601284 CGCCGCCGCCACGTGTGCCCAGG + Exonic
1080386220 11:31812652-31812674 CGAAGCCGCCGAGAGAGCTCGGG - Intronic
1080418601 11:32091463-32091485 CGCCGCCCCCCACGGGGCCCTGG - Intronic
1081700080 11:45147107-45147129 TGCCGCCGCCGCGGGAGCCGGGG + Intronic
1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG + Exonic
1081872669 11:46390691-46390713 CGCCGTGGTCGAAGGAGCCCTGG + Intergenic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083970313 11:66070415-66070437 CGCCGCCGCGGGGGAAGCCTGGG + Intronic
1084265624 11:68003881-68003903 CGCCCCCGCCGGGGGGACCCTGG + Intronic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1088764505 11:112962643-112962665 CGCCGCCGCCCAGAGAACCTCGG + Intronic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1202825081 11_KI270721v1_random:85919-85941 AGCAGCCGCCTGGGGAGCCCCGG - Intergenic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1094041194 12:26122924-26122946 CCCGGCGGCCGAGGGAGCGCCGG + Exonic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1094567869 12:31616482-31616504 CGCGGCCCCGGAGGGAGCCCCGG + Intergenic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097227672 12:57488138-57488160 GGCCGCCGCCGGGAGAGCCCGGG + Exonic
1098161031 12:67648632-67648654 GGCCGCGGCCGGGGGAGCCGGGG + Intronic
1098369144 12:69738871-69738893 GGCAGCCGCCGAGGGAACGCGGG - Intronic
1099716297 12:86296874-86296896 TGCCGCCGAAGTGGGAGCCCAGG + Intronic
1101466926 12:104958370-104958392 CGCCGCCGCCGGGGAAGCCCGGG + Intronic
1101504227 12:105331149-105331171 CGTCTCTGCCGAGGGAGCGCGGG + Intronic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103368068 12:120397858-120397880 CGCGGCCACAAAGGGAGCCCGGG + Intergenic
1104448837 12:128853526-128853548 CGCCGCCGCCGACCAGGCCCCGG - Exonic
1105472021 13:20703582-20703604 CGCCGCCAGCGAGGGAGCCCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112438463 13:99408277-99408299 CGCCACCGGCGGGGCAGCCCAGG - Intergenic
1112580639 13:100674395-100674417 CGCCCGGGCCGAGGGAGCGCCGG + Intronic
1113841702 13:113364474-113364496 CGCCGCGGCCTCGGAAGCCCCGG - Intergenic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1115479670 14:33849236-33849258 AGCCGCCACAGAGGGAGCCACGG + Intergenic
1116945397 14:50831028-50831050 CGGCGCCGCCGCGGGAACCATGG + Exonic
1119262533 14:73245985-73246007 CGCCCGAGCCCAGGGAGCCCAGG - Intronic
1121342699 14:93115030-93115052 CGCCGGCGCCCGGGGACCCCCGG - Intronic
1122153951 14:99739238-99739260 CGCCGGGGCTGCGGGAGCCCCGG + Intronic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122917487 14:104865669-104865691 CGCCGCCGCGGAGGCGGCCCTGG + Intronic
1122947698 14:105020777-105020799 GGCCGCTGCTGAGGGGGCCCGGG - Intronic
1123024883 14:105419872-105419894 CGCCGCCGCCGAGGCCGCCGAGG - Exonic
1124628775 15:31325928-31325950 CGCCGCTGCTGAGGGAACGCGGG - Intergenic
1124848083 15:33311027-33311049 CGCCGACGCCTCGGGAGCCATGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1126113292 15:45187768-45187790 CGCCCCCCCCGCGGAAGCCCAGG + Intronic
1129844990 15:78764081-78764103 CGCCGCAGCTGCGGGAGCACTGG + Exonic
1131277472 15:90994269-90994291 AGTCGGCGCCGAGGGAGGCCGGG - Intronic
1132251968 15:100341298-100341320 CGTCGCCGCCGTCGGGGCCCGGG + Exonic
1132500068 16:281147-281169 CGCCGCCTCCCATGGCGCCCCGG - Intronic
1132512823 16:352692-352714 CGCCGCCGGCGGGGGCGCTCGGG - Intergenic
1132837132 16:1959770-1959792 AGAGGCCGGCGAGGGAGCCCCGG - Intronic
1132889534 16:2196885-2196907 CGCGGCCGCCGGGGGTGCACTGG + Intergenic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133924761 16:10183299-10183321 CGTCGCCGCCGAGGGACTGCGGG - Intergenic
1133933721 16:10252389-10252411 AGCCGCCGCGGCGGCAGCCCGGG - Intergenic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136428285 16:30183504-30183526 GGCGGCCGCAGCGGGAGCCCGGG + Exonic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137300593 16:47144220-47144242 AGCCGCCGCGCAGGGCGCCCGGG + Intergenic
1137426442 16:48384966-48384988 CGCCCCCGCCCCTGGAGCCCCGG - Intronic
1137617088 16:49854963-49854985 CCCCTCCGCGGAGGGCGCCCCGG - Intronic
1139355822 16:66366620-66366642 CCCCGCTGGCGAGGGAGGCCTGG - Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139847838 16:69933171-69933193 CGTCGACGCAGAGGGTGCCCCGG - Intronic
1141079176 16:81035869-81035891 CGCCGCCTCCGAGGCCGCCATGG - Exonic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141770962 16:86089434-86089456 CGCTGCAGCCGAGGGATCCCAGG + Intergenic
1141831345 16:86511375-86511397 CGCGGACGCCGAGGGCGGCCAGG - Exonic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1203081528 16_KI270728v1_random:1148072-1148094 CGCCGCCGCCAACGGAGTCTCGG - Intergenic
1142980551 17:3668739-3668761 CGCCTGCGCCGTGGGCGCCCCGG - Intronic
1143078799 17:4366427-4366449 CGCCGGAGCCGAGGAAGGCCGGG + Exonic
1143448812 17:7023683-7023705 CGCCGCCCCGGAGGGAGCGCTGG + Exonic
1143478895 17:7217577-7217599 GGCAGCGGCCGAGGGAGCCGTGG + Intronic
1146251159 17:31345454-31345476 CGCGGCCCCGGAGGGAGCCCCGG - Intronic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1148366249 17:47057764-47057786 TGCCGCCAAAGAGGGAGCCCAGG + Intergenic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148680606 17:49471320-49471342 AGCCTCCGCAGAGGGAGCCCTGG + Intronic
1148945758 17:51260493-51260515 GGCCGCCGCCGCCGAAGCCCCGG - Intergenic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1150212072 17:63446860-63446882 CGCCGCCGCTCCGGGAGCCCTGG + Intergenic
1151828688 17:76537561-76537583 CGCCGCCGCCGAGCAAAGCCGGG - Exonic
1151919141 17:77140859-77140881 GGCCGCGGCCGAGGGAGCGGGGG - Intronic
1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG + Intergenic
1152237896 17:79147998-79148020 CGCCGCTGCCGTGGGGCCCCGGG + Intronic
1152887461 17:82860821-82860843 CCCCGCCCCTGAGGGAGGCCAGG + Intronic
1153900616 18:9614505-9614527 CGCGGCCGCCCGGGGAGCCGGGG + Exonic
1155221378 18:23689342-23689364 CGCCGCCTGGGTGGGAGCCCGGG + Intergenic
1156036151 18:32770277-32770299 CGCCGCCGCAGGAGGAGCCCGGG - Exonic
1157545201 18:48541383-48541405 CGCCGCCGCTGCTGGAGCCAGGG + Intronic
1157867329 18:51197633-51197655 CGCCGCCGCCGCGCGCGCCGGGG - Intronic
1158931084 18:62325463-62325485 CGACGCCTCCTCGGGAGCCCCGG + Intronic
1160588783 18:79928087-79928109 CACCGCGGCCAAGGGAGCCATGG + Intronic
1160765220 19:804584-804606 GGCCGCCGCCGAGGCAGCCAAGG - Exonic
1160870444 19:1275418-1275440 CGCCTCCGCCTGGTGAGCCCCGG - Exonic
1161380281 19:3961193-3961215 CGCGGCCGTGGTGGGAGCCCAGG - Intronic
1161583589 19:5093431-5093453 AGCCGAAGCCCAGGGAGCCCTGG + Intronic
1162019930 19:7863735-7863757 CGCAGCCGCGGGGGGCGCCCGGG + Intronic
1162106928 19:8375639-8375661 TGCCGCCACAGTGGGAGCCCAGG - Intronic
1162959491 19:14117616-14117638 CGCCGCCGCCCAGCGCGCTCCGG - Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163606799 19:18280262-18280284 CCCCCCCCCCGAGGGTGCCCAGG - Exonic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1163607067 19:18281365-18281387 CGCGGCCGTCGGGGGCGCCCCGG + Exonic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1164722797 19:30444555-30444577 CGCCACCGCCGTTGGGGCCCTGG - Exonic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165961646 19:39539861-39539883 TGCCGCCGCCGGGGCTGCCCTGG + Exonic
1166245420 19:41522215-41522237 CGCCGCCGCCGAGGCTTACCCGG - Intergenic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1202715238 1_KI270714v1_random:38701-38723 CGCCTCCCCAGAGGGAGGCCAGG + Intergenic
925009055 2:468266-468288 CGAGGCCGTCCAGGGAGCCCTGG + Intergenic
925128421 2:1477619-1477641 CGCAGCCACCCAGGGCGCCCAGG - Intronic
925611681 2:5706782-5706804 CGGCGCCCCGGAGGGAGCCAGGG + Intergenic
926077159 2:9951174-9951196 CGCCCCCGCCGGGCGAGCGCAGG + Intergenic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927713819 2:25340915-25340937 CGCCGCCACCGCGGCCGCCCGGG + Intronic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
928093880 2:28392567-28392589 CGGAGGCGCCGAGGCAGCCCCGG - Intronic
929188791 2:39120994-39121016 CGCCGCCGCCGGTGTAGCGCTGG + Exonic
931348999 2:61471358-61471380 CGCGGCCGCGGGGGGAGTCCGGG + Intergenic
932345883 2:70994884-70994906 CGCCGCCGCCGAGAGGAGCCCGG + Exonic
932496574 2:72148606-72148628 CGCAGCCGGCGACAGAGCCCCGG + Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934661383 2:96145398-96145420 CGCCACCGCCACGAGAGCCCGGG - Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
936512296 2:113157785-113157807 CGCCCGCGGCGAGAGAGCCCAGG - Intronic
938073043 2:128318419-128318441 CGCGGCCGCCGGGCGCGCCCAGG + Exonic
938727285 2:134120123-134120145 GGCCGCCGCCGAGCGGGCCGCGG - Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942681348 2:178480624-178480646 CGCCGCCGCCGAGGCTTACCCGG + Exonic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946692520 2:222319966-222319988 GGTCGCCGCGAAGGGAGCCCCGG - Intergenic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169044419 20:2524643-2524665 GGGCCCCGCCGGGGGAGCCCAGG + Intronic
1169143492 20:3238662-3238684 CGGCGCCGCGGTGGGAGCCCCGG - Intronic
1170150267 20:13220988-13221010 CGCTGCCGCCGAGGGCGCCCCGG + Intergenic
1172285094 20:33734595-33734617 TGCCGCCCCAGAGGGTGCCCTGG + Intronic
1175268711 20:57718770-57718792 AGCCGCCGCCGCTGCAGCCCCGG - Intergenic
1175856432 20:62123028-62123050 TCCCGCCGCCCTGGGAGCCCAGG - Intronic
1175871322 20:62210788-62210810 AGCCGAGGCCCAGGGAGCCCCGG + Intergenic
1175911486 20:62407246-62407268 GGCCGCGGCCGGTGGAGCCCCGG - Exonic
1175999788 20:62826687-62826709 GGCCGCCCCTGAGGGAGCACTGG + Intronic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176377082 21:6092087-6092109 CCCTGCCTCCAAGGGAGCCCCGG + Intergenic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179746393 21:43446157-43446179 CCCTGCCTCCAAGGGAGCCCCGG - Intergenic
1180067221 21:45418485-45418507 CGCCGCCCCAGAGCCAGCCCGGG - Intronic
1180285449 22:10741518-10741540 CCCGGGCTCCGAGGGAGCCCCGG + Intergenic
1180612916 22:17109229-17109251 CGCCGCAGAGGAGGGGGCCCTGG + Exonic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181934624 22:26429619-26429641 CGCCCCCGCCGAGGATGCTCCGG + Intronic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182578977 22:31292390-31292412 AGCCGCCGCCAAGGGGGCCTCGG - Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183466544 22:37983135-37983157 CGCCGCCCCGTAGGGAGACCCGG + Intronic
1183702294 22:39457424-39457446 AGCCGCTGCCGCCGGAGCCCGGG + Exonic
1184153153 22:42649817-42649839 CGCCGCCGGCGAGGAGGCTCCGG - Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184663711 22:45976941-45976963 CGCCACCGCCGCGTGAGCCCGGG + Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185249926 22:49795839-49795861 AGCCGCCTCAGAGTGAGCCCAGG - Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185374285 22:50474952-50474974 CGCCGCCGCGGAGCGAACCAGGG - Exonic
1185387042 22:50538339-50538361 AGCCGTCGCTGAGGGAGGCCTGG - Intergenic
1185409661 22:50674944-50674966 GGCCCCCGCCGAAGGAGTCCGGG - Intergenic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
949260501 3:2098843-2098865 CGCCGCGCCAGACGGAGCCCGGG + Intronic
950496674 3:13338054-13338076 CTCCTCTGCCGAGGGAGGCCTGG + Intronic
950940306 3:16884768-16884790 CTCCGGCGCCGGCGGAGCCCCGG - Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
951613950 3:24521824-24521846 CGCCGCAGCCGCTGGAGCCTTGG + Intergenic
953099323 3:39809694-39809716 CGCAGCCGCAGCGGGAACCCGGG - Exonic
954093240 3:48301631-48301653 CCCTCCCGCCGAGGGCGCCCAGG - Intronic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
955368736 3:58332951-58332973 CGCCGCCGCCTAGGGACGCGAGG - Exonic
958900136 3:99876274-99876296 CGCCGCGGCCGAGGGTCCCGCGG - Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
959849713 3:111071959-111071981 CGCCGGGGCCGGGGGAGCCGGGG + Exonic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961081521 3:124032922-124032944 CGGGGCCGCCGGGCGAGCCCGGG - Intergenic
961574450 3:127823216-127823238 CCCCGCCGCCGAGCCGGCCCAGG - Intronic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
963509220 3:146225907-146225929 TGCCGCCGAAGTGGGAGCCCAGG + Intronic
964118044 3:153156201-153156223 TGCCGCCGAAGTGGGAGCCCAGG + Intergenic
965044203 3:163552802-163552824 TGCCGCCGAAGTGGGAGCCCAGG + Intergenic
966854309 3:184183793-184183815 CTCCCCTGCCCAGGGAGCCCAGG - Exonic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968659635 4:1793702-1793724 CGCCGCCGCCCAGGGCTCCCGGG - Intronic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
968820212 4:2844137-2844159 CCCCGCCCCCGAGGCTGCCCGGG - Intronic
968999039 4:3965174-3965196 TGCCGCCGAAGTGGGAGCCCAGG + Intergenic
969379198 4:6783044-6783066 AGCCGCCGCCGAGGGCTCCGGGG + Intronic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
973888453 4:55346335-55346357 GGCCTCCGCCCAGGGAGCCATGG - Exonic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
985593604 5:777886-777908 CCCCAGCACCGAGGGAGCCCGGG + Intergenic
985621771 5:959751-959773 CGATGCCGCGGAGAGAGCCCAGG + Intergenic
985823719 5:2178235-2178257 CCCTGGCGCTGAGGGAGCCCTGG + Intergenic
987146321 5:14994286-14994308 CGCCGCCAAAGTGGGAGCCCAGG + Intergenic
988796448 5:34656800-34656822 GGCCGCGGCGGAGGGAGCGCGGG + Intronic
988823976 5:34915913-34915935 CGCCGCCGCAGGTGTAGCCCGGG - Exonic
989229985 5:39074473-39074495 CGTCGCCGCCGAGGGGGCGGGGG - Intergenic
990412221 5:55552597-55552619 CGCGGCCCCGGAGGGAGCCCCGG + Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
991436085 5:66597584-66597606 CAGCGCCACCGAGGGAGCGCGGG - Intronic
994175117 5:96702719-96702741 CGGCCCCGCCCCGGGAGCCCGGG - Intronic
996530322 5:124521502-124521524 TGCCGCCGAAGTGGGAGCCCAGG - Intergenic
996585930 5:125088586-125088608 TGCCGCCAAAGAGGGAGCCCAGG - Intergenic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997653011 5:135536030-135536052 CTCCGCCCCCGCGGCAGCCCGGG + Intergenic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
998374522 5:141682074-141682096 CGCCGGCGCCGAGGGGGCCTGGG + Intronic
998546080 5:143029045-143029067 GGCCACAGCCCAGGGAGCCCTGG + Intronic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
1000302925 5:159972210-159972232 CGCCGCGGCCCAGGTAGCCCGGG - Exonic
1001948027 5:175796740-175796762 CGCGGCCGACGAGGGCGCCCGGG - Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003081844 6:3027582-3027604 TGCCGCCGAAGTGGGAGCCCAGG - Intergenic
1003390328 6:5707895-5707917 GGGTGCCGCCGTGGGAGCCCGGG + Intronic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1006410991 6:33873092-33873114 CGCAGGCACCGTGGGAGCCCAGG + Intergenic
1006472654 6:34237327-34237349 CGCCGCCGCCGCGGGCCCCGGGG - Intronic
1006932645 6:37697147-37697169 CTCCGCCGCCGAGAGGTCCCCGG - Exonic
1007347130 6:41239694-41239716 CTGCGCCCCCGCGGGAGCCCGGG - Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1008956621 6:57222399-57222421 AGGCGCCTCCAAGGGAGCCCGGG + Intergenic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1015625936 6:135181191-135181213 CGCCGCCTCCGCGGTCGCCCTGG - Intergenic
1018374198 6:163195631-163195653 CGCCGAGGCGCAGGGAGCCCTGG - Intronic
1019045124 6:169139750-169139772 CTCCGCCGCCGAGGACGCCCAGG + Intergenic
1019197442 6:170290697-170290719 CGCCGCCGCCGAGTGACACCGGG - Intergenic
1019298399 7:290827-290849 CGCCGCCCCCGACGGGCCCCGGG + Intergenic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1022103810 7:27184608-27184630 CGCCGCCGCGGAGGTCGCCGTGG + Exonic
1022675485 7:32495460-32495482 CGCCGCCGGCGAGGCAGGGCTGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1028871152 7:95772752-95772774 CGCCGCTGCCGAGCGCGTCCAGG + Exonic
1028987741 7:97021358-97021380 CGCCGCCGCCGAGGACACTCGGG - Intronic
1029630659 7:101748133-101748155 GGCCGCCTCCGGGGGACCCCAGG + Intergenic
1029640334 7:101816184-101816206 CCCCGCCGCCGCGGGCCCCCCGG - Intronic
1029715134 7:102321555-102321577 CACCGCCGCCGAGGAGCCCCCGG + Exonic
1029988094 7:104940037-104940059 TGCCGCCAAAGAGGGAGCCCAGG - Intergenic
1030138704 7:106284573-106284595 CGCCGCCGCCGCGCGCCCCCAGG + Intronic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032693833 7:134316556-134316578 CCCCGCCGCCCACGGAGCCCGGG - Intronic
1033033199 7:137846719-137846741 GGCGGCCGCGGAGGGAGCGCAGG + Exonic
1033099843 7:138460607-138460629 CGGCGCCGCCGAGGGCCCCCCGG - Exonic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034977736 7:155457978-155458000 CGCCGCCGCCTGGGCCGCCCGGG - Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035363358 7:158328801-158328823 CCCCGCCACCCAGGGATCCCAGG + Intronic
1038038395 8:23705016-23705038 CGCCGCCGAGGAGGGACCCGAGG - Intronic
1039887567 8:41663898-41663920 CGCCCACGCCCTGGGAGCCCTGG - Intronic
1041201636 8:55455233-55455255 GGCCGCCGCGGAGCGAACCCGGG - Intronic
1042040214 8:64581378-64581400 CGCCGCCGCCCAGGCCCCCCGGG - Exonic
1042837754 8:73093070-73093092 CGCAGGCGCCGCCGGAGCCCTGG - Exonic
1043463994 8:80487065-80487087 CGGCGCCGCCGAGGAAGCCAAGG + Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048307263 8:133293056-133293078 CGCCCCACCCGAGGGAGCCCAGG + Intronic
1048655480 8:136530890-136530912 CGCCGCCAAAGTGGGAGCCCAGG + Intergenic
1049585220 8:143429881-143429903 CGCCGCCGCCCGCGAAGCCCGGG + Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1050744152 9:8857774-8857796 CGCCGCCGCCGAAGCCCCCCTGG + Intronic
1051079689 9:13279656-13279678 CACCGCCTCCGCGGCAGCCCCGG - Intergenic
1053230122 9:36400956-36400978 CGCCGGCGCATAGGGAGCCCGGG - Intronic
1054333345 9:63781682-63781704 CGCAGGCGCGGAGGGGGCCCAGG + Intergenic
1054835523 9:69672083-69672105 TGCGGCCCCCGACGGAGCCCGGG - Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055486835 9:76764496-76764518 GGCTGCAGCCGAGGGAGACCAGG + Intronic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1059176799 9:112175340-112175362 CGGCGCCGCCGAGGGAAGCGGGG + Intronic
1061451414 9:130668910-130668932 TGCTGCCACCGAGGGAGACCTGG - Intronic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062346722 9:136118485-136118507 CGCCGCCGCGGAGAGGGCACCGG - Exonic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1186496570 X:10015964-10015986 GGCCGCCGCCGAGAGCCCCCGGG + Intronic
1187281291 X:17860477-17860499 CGTCGGCGCCCCGGGAGCCCCGG - Intronic
1190225238 X:48539942-48539964 CCCAGCCGCCGAGGCATCCCAGG + Intronic
1195884425 X:109624669-109624691 CGCCGACGCCGAGGCTGCCGCGG - Exonic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196775428 X:119333475-119333497 TGCCGCCACAGTGGGAGCCCAGG - Intergenic
1196844983 X:119890480-119890502 TGCCGCCGAAGTGGGAGCCCAGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200146344 X:153928188-153928210 CGCGGGCGCCGTGGGAGCCTGGG + Intronic
1200151273 X:153952562-153952584 CGCAGCCACGGAGGAAGCCCAGG - Exonic