ID: 908404177

View in Genome Browser
Species Human (GRCh38)
Location 1:63797676-63797698
Sequence TGTATCTCAGGTTGCTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908404173_908404177 13 Left 908404173 1:63797640-63797662 CCTTCTATGAAAGCAAATGAACA 0: 1
1: 1
2: 3
3: 32
4: 376
Right 908404177 1:63797676-63797698 TGTATCTCAGGTTGCTGTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 167
908404172_908404177 14 Left 908404172 1:63797639-63797661 CCCTTCTATGAAAGCAAATGAAC No data
Right 908404177 1:63797676-63797698 TGTATCTCAGGTTGCTGTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908404177 Original CRISPR TGTATCTCAGGTTGCTGTGA GGG Intronic