ID: 908405724

View in Genome Browser
Species Human (GRCh38)
Location 1:63812254-63812276
Sequence AACAGGCCTCAGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908405724_908405727 -1 Left 908405724 1:63812254-63812276 CCAAATTTGGCCTGAGGCCTGTT No data
Right 908405727 1:63812276-63812298 TTTTATAAATAAAGTTTTGTTGG 0: 10
1: 235
2: 1166
3: 1662
4: 2972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908405724 Original CRISPR AACAGGCCTCAGGCCAAATT TGG (reversed) Intronic
No off target data available for this crispr