ID: 908407402

View in Genome Browser
Species Human (GRCh38)
Location 1:63828836-63828858
Sequence GTGCTGAAGCAGGAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908407402_908407406 1 Left 908407402 1:63828836-63828858 CCAGGCTACTCCTGCTTCAGCAC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 908407406 1:63828860-63828882 TTGGAGACCACAGACCAGCAGGG 0: 2
1: 0
2: 1
3: 43
4: 281
908407402_908407409 23 Left 908407402 1:63828836-63828858 CCAGGCTACTCCTGCTTCAGCAC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 908407409 1:63828882-63828904 GATCACTCCCTCTCCTCTTCTGG 0: 1
1: 0
2: 1
3: 25
4: 239
908407402_908407410 24 Left 908407402 1:63828836-63828858 CCAGGCTACTCCTGCTTCAGCAC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 908407410 1:63828883-63828905 ATCACTCCCTCTCCTCTTCTGGG 0: 1
1: 0
2: 2
3: 25
4: 327
908407402_908407405 0 Left 908407402 1:63828836-63828858 CCAGGCTACTCCTGCTTCAGCAC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 908407405 1:63828859-63828881 TTTGGAGACCACAGACCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908407402 Original CRISPR GTGCTGAAGCAGGAGTAGCC TGG (reversed) Intronic
900154729 1:1199329-1199351 GGGGTGAAGCAGGAGGGGCCTGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901234587 1:7661157-7661179 GTGCAGATGCAGGAGAGGCCAGG - Intronic
901534882 1:9875592-9875614 GAGTTGAAGCAGGAGTAGCCTGG - Intronic
901550560 1:9993100-9993122 CTGCTGGTGGAGGAGTAGCCAGG + Intergenic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
902657248 1:17877693-17877715 GTGTTGAAGCAGAAGTCCCCTGG - Intergenic
902992233 1:20196360-20196382 GGGCTGATGCAGGATCAGCCAGG - Intergenic
906311294 1:44756434-44756456 GTGCTGAGGCAGGGCTGGCCAGG + Intronic
906460450 1:46032158-46032180 GTTCTGGAGAAGGAGAAGCCAGG - Exonic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
909803162 1:79840090-79840112 CTGCAGAAACAGGTGTAGCCAGG + Intergenic
911310818 1:96289760-96289782 GGGCTGAAGCAGGAGAAAGCTGG - Intergenic
912231150 1:107794223-107794245 GGGCTGGCCCAGGAGTAGCCTGG + Intronic
913014877 1:114722650-114722672 GTGCTGAAGAATGAGTGGACTGG + Intronic
915939544 1:160110045-160110067 GCGCTGAGGCAGAAATAGCCTGG + Intergenic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
921562514 1:216675584-216675606 GTGGTGAATCAGCAGTAGCATGG + Intronic
921667872 1:217894595-217894617 GGGCTGAGGCAGGAGAAACCGGG - Intergenic
922722497 1:227905980-227906002 GGACTGAAGCTGGAGGAGCCTGG + Intergenic
923099501 1:230801110-230801132 GAGCTGAAGGAGAAGTAGCATGG - Intronic
923781868 1:237032014-237032036 GTGCTGAAGATGCAGAAGCCGGG - Intergenic
924258796 1:242209072-242209094 ATGCTGAAATAGGAGAAGCCAGG - Intronic
924878981 1:248137154-248137176 GTGCTGAGGCGGGAGGAGACTGG - Intergenic
1065776654 10:29126547-29126569 GAGCTGCAGGAGGAGTAGCTGGG + Intergenic
1067544257 10:47181534-47181556 ATGCTGCAGCATGACTAGCCCGG + Intergenic
1067723130 10:48744925-48744947 GTGCTGAAGCAGAAAAAGCAAGG - Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1069791703 10:71026807-71026829 GGGCTCCATCAGGAGTAGCCAGG - Intergenic
1070736516 10:78867028-78867050 GTCCTGAGGCAGCAGGAGCCTGG - Intergenic
1071191607 10:83108237-83108259 GGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1071813300 10:89206915-89206937 GTGCAGCAGCAGGAGCAGCTCGG + Exonic
1072026819 10:91467773-91467795 GTACTCATGCAGCAGTAGCCTGG - Intronic
1072439496 10:95441287-95441309 GAGCTGAACCAGGAGTCACCTGG + Intronic
1073293538 10:102425060-102425082 GTGCTGGAGCTGGAGCTGCCGGG - Intronic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1074913939 10:117937975-117937997 GTGCAGTAGCAGGAGTGGCGAGG - Intergenic
1076392284 10:130111686-130111708 GTGCTAAGGCAGGAGGGGCCTGG - Intergenic
1076818171 10:132924761-132924783 GTGCTGCAGCAGGGGCAGGCAGG + Exonic
1077052786 11:575374-575396 ATGCTGAAGGCGGAGTTGCCAGG - Intergenic
1079097168 11:17518463-17518485 GTGGTTATGCAGGAGTTGCCAGG - Intronic
1082128131 11:48456040-48456062 TGGCTGAAGCTGGAGCAGCCTGG + Intergenic
1084288590 11:68147350-68147372 GAGCAGGAGCAGGGGTAGCCCGG - Intergenic
1085145422 11:74191658-74191680 TGGCTGGAGCATGAGTAGCCAGG - Intronic
1087757191 11:102066963-102066985 GTGCTGAAGCAGGAAAGTCCTGG + Intronic
1088876492 11:113940778-113940800 GTGATGGAGCAGGAGGTGCCGGG - Intronic
1090450206 11:126799672-126799694 GGGGTGGAGCAGGAGGAGCCGGG + Intronic
1090936430 11:131346960-131346982 GAGCTGAATCAGAGGTAGCCTGG + Intergenic
1091275259 11:134345374-134345396 GTCCTGAAGCATGAGATGCCAGG - Intronic
1091795040 12:3293322-3293344 GTGCTGAAGCAGGAAAAGGGAGG + Intergenic
1093490584 12:19700350-19700372 GGGCTGAAGGAGGAGGAGCTGGG + Intronic
1096399413 12:51292736-51292758 GTGGTGAAGAATGAGTTGCCTGG + Intronic
1096583266 12:52601872-52601894 CTTCTGAAGCAGAAGCAGCCTGG - Intergenic
1096995013 12:55832955-55832977 GTCTTGAAGCAGCAGTAGCCTGG - Intergenic
1097179027 12:57160388-57160410 GCCCTGAGGCAGGAGGAGCCGGG - Intronic
1098703948 12:73664483-73664505 GAGCTGAAGCAGGAGAAAGCCGG + Intergenic
1099013841 12:77322856-77322878 GGGATGAAGCAGGAGTAGGTAGG + Intergenic
1101373302 12:104149975-104149997 GTGCTGAGGCAGGCTGAGCCTGG + Intergenic
1103209010 12:119153621-119153643 GGGCTGTAGCGGGAGTAGCTAGG - Exonic
1105436702 13:20385553-20385575 CTGCTAAACCAGGAGTAGGCAGG - Intergenic
1107250971 13:38362500-38362522 AGGCTGAGGCAGGAGAAGCCTGG - Intronic
1107994985 13:45850845-45850867 GTACTGGAGCAGGATTTGCCTGG - Intronic
1108046401 13:46388108-46388130 AGGCTGAAGCAGGAGCAACCCGG + Intronic
1110654961 13:77987035-77987057 GTCCTGAAGCAGTAGGAGGCAGG - Intergenic
1113579683 13:111420268-111420290 GAGCTGGAGCAGGACCAGCCTGG + Intergenic
1114066404 14:19062596-19062618 GTGCGGACGCTGCAGTAGCCAGG - Intergenic
1114095864 14:19337428-19337450 GTGCGGACGCTGCAGTAGCCAGG + Intergenic
1114183600 14:20384119-20384141 GTCCTGAAGAAGGCGTGGCCGGG + Exonic
1114568414 14:23648879-23648901 GTGCTGAAGCTAGAGTGGCAGGG - Intergenic
1114677770 14:24456162-24456184 GTGATCAAGGAGGAGTACCCTGG + Intergenic
1117590191 14:57259520-57259542 GTTAGGAAGCAGGAGTAGCATGG - Intronic
1121021093 14:90580602-90580624 GTGCAGAAGCAGCACTAGCAAGG - Intronic
1121973194 14:98378315-98378337 AGGCTGAAGCAGGAGAACCCAGG + Intergenic
1122428307 14:101624221-101624243 GCCCTGAGGCAGGAGTTGCCTGG - Intergenic
1122723001 14:103732502-103732524 GTGCTGCTCCAAGAGTAGCCTGG - Intronic
1123878634 15:24652446-24652468 GTGCAGATGTAGAAGTAGCCTGG + Intergenic
1126770202 15:52048513-52048535 AGGCTGAAGCAGGAGAATCCAGG + Intronic
1126936029 15:53708765-53708787 GTGCTGAAGTGGGAATAGCTGGG - Intronic
1128473800 15:67979664-67979686 GACCTGTAGCAGGAGCAGCCAGG - Intergenic
1128693041 15:69739789-69739811 GCTCTGAGGCAGGAGGAGCCTGG + Intergenic
1128862610 15:71086545-71086567 GTGAGGGAGCAGGAGTATCCAGG + Intergenic
1129825894 15:78634828-78634850 GTGCTGAGGGAGGAGGTGCCTGG - Intronic
1129948077 15:79559553-79559575 GTGCTGAAGCGGGTGGAGTCCGG - Intergenic
1130086230 15:80780089-80780111 GTGCTGAGGCAGGAGCAGCAGGG - Intronic
1130675780 15:85950718-85950740 ATGCTGAAGCAGGAAAGGCCTGG - Intergenic
1131750415 15:95500595-95500617 GTGCTGAAGTGGGTGGAGCCAGG + Intergenic
1131800103 15:96059727-96059749 GTGCTGAAGTATCATTAGCCAGG + Intergenic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1132930808 16:2458351-2458373 AGGCTGAGGCAGGAGTATCCGGG - Exonic
1133803265 16:9102017-9102039 AGGCTGAAGCAGGAGAACCCTGG + Intronic
1134021415 16:10923858-10923880 ATGCTGTAGCGGGAGGAGCCAGG - Exonic
1134300086 16:12983140-12983162 CTGCTGAGGCAGGAAAAGCCAGG + Intronic
1135798939 16:25474642-25474664 GAGCTGAAGGAGAGGTAGCCTGG - Intergenic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137905860 16:52321290-52321312 GTGCTGAAGGTGGAGAAGCAGGG + Intergenic
1139496977 16:67326911-67326933 GCGCTGACGCTGGAGCAGCCGGG + Exonic
1140484188 16:75281021-75281043 GGGCAGAAGTATGAGTAGCCTGG - Intergenic
1142624527 17:1183365-1183387 GTGATGAGGCAGGAGCAGGCAGG - Intronic
1142961396 17:3554462-3554484 GTGCTGAGGCAGGAGCAGTCAGG - Intronic
1143103838 17:4518789-4518811 CTGCTGAAGCAGGAGTCGCTGGG - Intronic
1145936875 17:28719399-28719421 GTGCTGGAGCAGGATTTGCTCGG - Exonic
1147360160 17:39925247-39925269 GTCCTGCAGCAGGAGGAACCAGG + Exonic
1147447656 17:40484579-40484601 CTGCTGAGGAAGGAGGAGCCAGG - Exonic
1148208349 17:45793489-45793511 GTCATGAGGCAGGAGTAGCCAGG + Intronic
1148930029 17:51120616-51120638 GTGGTGTATCAGGAGGAGCCCGG - Exonic
1149679254 17:58493647-58493669 GTGCAAAAGCAGCCGTAGCCAGG - Intronic
1150458495 17:65327517-65327539 GTTCTGAAACAGGAGAAACCTGG + Intergenic
1150805554 17:68316043-68316065 GAGATGAAGCTGGAGTAGGCAGG - Intronic
1150806849 17:68326205-68326227 GTGCTGCTGCAGGTGTAGCCGGG + Intronic
1150807226 17:68329074-68329096 GTGCTGCTGCGGGTGTAGCCGGG + Intronic
1150837354 17:68576490-68576512 GGGCTGCAGCATGAGGAGCCAGG - Intronic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151951633 17:77357452-77357474 GTGATAAAGCAGGTGTAGCTTGG - Intronic
1153357715 18:4155998-4156020 GTTCTGAAGCAAGAGTTGACAGG + Intronic
1156035876 18:32768550-32768572 GTGGTTAGGCTGGAGTAGCCTGG + Intronic
1156475804 18:37404607-37404629 GTGCTGGAGCAGGTCGAGCCAGG - Intronic
1158101512 18:53834800-53834822 TGGCTGAAGCTGGAGTAGCTGGG - Intergenic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1161266434 19:3366727-3366749 GTTTTGAAGCAGGAGGAGGCGGG + Intronic
1161417770 19:4157220-4157242 GTGGTGGAGCAAGAGTTGCCAGG - Exonic
1163032399 19:14553239-14553261 GTGCAGAGGCAGCGGTAGCCCGG - Intronic
1163082298 19:14952884-14952906 GTGCAGAAGCAGGAGCACCAGGG + Intronic
1165045008 19:33097830-33097852 GTTCTGAAGGACGAGGAGCCTGG + Exonic
1165438479 19:35810164-35810186 AGGCTGAAGCAGGAGAACCCGGG + Intronic
1166388665 19:42396747-42396769 GTTCTGAAGGAGGAGAAGTCTGG - Intergenic
1167152219 19:47716844-47716866 CTGCTGGAGCAGGAGGTGCCCGG + Exonic
1167473828 19:49689205-49689227 GCACTGAAGCAGGTGTAGCCAGG - Exonic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167792807 19:51691608-51691630 GTCCTGATGCAGGAGGAGGCTGG + Intergenic
1167960905 19:53103514-53103536 GGGCTGAAGCAGGGGCCGCCAGG + Intergenic
926629609 2:15124674-15124696 CAGCTGGAGCTGGAGTAGCCAGG - Intergenic
927302806 2:21535811-21535833 CTGCTGGAGCTGGAGTGGCCAGG - Intergenic
927638650 2:24833339-24833361 GTGCTGAGGCTGGAGTGGCCTGG - Intronic
928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG + Intronic
929398008 2:41545712-41545734 GGGCTCAAGGAGAAGTAGCCAGG + Intergenic
929437348 2:41938869-41938891 GTGCTGAAGGACCAGGAGCCAGG + Intronic
929979900 2:46668650-46668672 GTGGAGAAGCAGGAGTCGCAAGG - Intergenic
931089395 2:58869280-58869302 TAGCTGAAGCAGGTGGAGCCAGG + Intergenic
932369487 2:71175550-71175572 GGGCTGAAGCCTGAGTAGCTGGG + Intergenic
934099572 2:88640510-88640532 GGGCTGAAGCAGGAGAAAGCTGG + Intergenic
935442873 2:103122705-103122727 GTCCTGGAGCTGGAGCAGCCTGG - Intergenic
935729455 2:106053394-106053416 GTGTTGAATGATGAGTAGCCCGG + Intergenic
937418598 2:121737005-121737027 GGGTTGGAGCAGGAGTTGCCCGG + Intergenic
938380236 2:130832322-130832344 GGGGTGAAGCAGGAGGGGCCAGG - Intergenic
938483796 2:131682729-131682751 GTGCGGACGCTGCAGTAGCCAGG - Intergenic
938717098 2:134030632-134030654 GGGCTGAAGCAGGATTGGGCAGG - Intergenic
942250086 2:174040050-174040072 GTCCTGAAGGAGGAGAAACCTGG + Intergenic
946195481 2:218030291-218030313 GAGCTGAAGCAAGAGCAGCTGGG - Intergenic
947420445 2:229937616-229937638 CTGCTGAAGCAGGGAGAGCCAGG - Intronic
948601897 2:239112078-239112100 GTGCTGAGCCAGGAGCAGCCTGG + Intronic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
948839664 2:240642713-240642735 GTGCAGCAGCAGGACTCGCCTGG - Intergenic
948863346 2:240763466-240763488 GGGCTGAAGAAGGAGTGGCTGGG - Intronic
1170736351 20:19016892-19016914 GTGCTGAAGTAAGACTAGGCTGG - Intergenic
1171237233 20:23536825-23536847 GGCCTGAAGCAGCAGCAGCCTGG - Intergenic
1171343021 20:24445273-24445295 GAGCTGAAGCAGCAGTTTCCAGG + Intergenic
1171880685 20:30615905-30615927 GGACTGAATCAGAAGTAGCCAGG + Intergenic
1171969320 20:31553841-31553863 GTTCTGAAGCAGGGTGAGCCCGG - Intronic
1173294977 20:41748257-41748279 GTGCTCAGGCAGGAGTAGGGTGG + Intergenic
1176198881 20:63850929-63850951 GGGCTGAAGCAGGCGTCTCCAGG - Intergenic
1176259815 20:64173670-64173692 ATGCTGCAGGAGGAGAAGCCAGG - Intronic
1176259905 20:64174120-64174142 ATGCTGCAGGAGGAGAAGCCAGG - Intronic
1176260006 20:64174620-64174642 ATGCTGCAGGAGGAGAAGCCAGG - Intronic
1176260209 20:64175620-64175642 ATGCTGCAGGAGGAGAAGCCAGG - Intronic
1176260342 20:64176270-64176292 ATGCTGCAGGAGGAGAAGCCAGG - Intronic
1176260354 20:64176323-64176345 ATGCTGCAGGAGGAGAAGCCAGG - Intronic
1179603794 21:42499096-42499118 GTGCTGCTGCAGGAGATGCCGGG - Intronic
1179840849 21:44072312-44072334 ATGCAGAAGCAAGAGCAGCCAGG - Intronic
1180484882 22:15785187-15785209 GTGCGGACGCTGCAGTAGCCAGG - Intergenic
1180995339 22:19962713-19962735 GTGCTGCAGCATGCGGAGCCCGG + Exonic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1184099099 22:42332366-42332388 GAGCTGGAGCAGGAACAGCCAGG + Intronic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1185190364 22:49432646-49432668 GTGCTGAGGCAGGGGCAGGCGGG - Intronic
949509278 3:4754224-4754246 GGGCTGAAGCAGGAGTTGCAGGG - Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
955416432 3:58696323-58696345 GAGCTGAAGCAGAACTAGACAGG + Intergenic
955825101 3:62937679-62937701 GGGCAGTAGGAGGAGTAGCCAGG + Intergenic
956414455 3:69012724-69012746 GAGCTGAAGGAAAAGTAGCCTGG - Exonic
957103962 3:75862465-75862487 GTGCTGAAGCTGGCTTATCCTGG - Intergenic
960927789 3:122813146-122813168 AGGCTGAAGCAGGAGAATCCGGG + Intronic
961554375 3:127688227-127688249 GTGCTGGAGGAGGAGAAGGCAGG + Intergenic
961801916 3:129457454-129457476 GCCCTGAAGCAGGAAAAGCCTGG - Intronic
963824173 3:149933123-149933145 GAGCTGAGGCTGGAGCAGCCAGG + Intronic
964788510 3:160427345-160427367 AGGCTGAAGCAGGAGTATGCTGG + Intronic
966714404 3:183000920-183000942 GGGCTGAAGCAGGAGAAAGCTGG - Intergenic
967396554 3:189015667-189015689 CAGCTTAAGCAGGAGTAGCTGGG - Intronic
967805937 3:193714792-193714814 CAGCTGAAGCTGGAGTGGCCAGG - Intergenic
968644200 4:1730818-1730840 GTGCTGGAGCAGGGGACGCCGGG + Intronic
968756749 4:2420121-2420143 GAGATCAAGCAGGAGTGGCCAGG - Intronic
970190315 4:13509766-13509788 GAGCTGCAGCTGGAGCAGCCAGG - Intergenic
972629653 4:40832449-40832471 GTGAGGAAGCAGGAGTAGGTTGG - Intronic
972712249 4:41609102-41609124 CCCCTGAAACAGGAGTAGCCTGG - Intronic
972731995 4:41803754-41803776 GTGCTAAAACTGGAATAGCCTGG + Intergenic
976226150 4:82797346-82797368 TTACTGAAGCGGCAGTAGCCAGG - Intronic
976378673 4:84374756-84374778 CAGCTGAAGCAGGTGTAGCTGGG - Intergenic
976731992 4:88272194-88272216 GAGCTGAAGCAGTAGCAGCACGG + Intronic
977617695 4:99104531-99104553 GTAGTGAGGCAGGAGAAGCCAGG + Intergenic
981634687 4:146863315-146863337 GAGCTTAAGCAGGAGTATCCAGG - Intronic
982306830 4:153941316-153941338 GAGATGAAGCAAGAGTAGTCAGG - Intergenic
984824044 4:183907775-183907797 ATGCTGAAGGAGGAAAAGCCTGG + Intronic
985521147 5:374320-374342 GTGCAGACCCAGGAGAAGCCAGG - Intronic
986035272 5:3931187-3931209 TGGCTGAAGCAGGAGGTGCCAGG - Intergenic
987867863 5:23569570-23569592 AGGCTGAAGCAGGAGAAGGCAGG + Intergenic
988645791 5:33093514-33093536 GAGCTGAAGCAGGAGGAAGCTGG - Intergenic
990449366 5:55920300-55920322 CTGCTGCAGCAGGAGTAACTAGG - Intronic
991096943 5:62749734-62749756 GTGCTGAAAAAGAAGTAGGCAGG - Intergenic
991594699 5:68290553-68290575 CTGATGAAGCAGGAGTGGTCTGG + Intronic
995615884 5:113963416-113963438 GCGCTGCAGCAGGATTATCCTGG - Intergenic
995623876 5:114056116-114056138 GTACCGAAGCAGGGGCAGCCAGG + Intergenic
999237369 5:150106967-150106989 GTTCTGCAGCAGGAGTTTCCTGG + Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
1000003632 5:157163473-157163495 CTGCTGAAGGAGGAGCAGCAAGG - Exonic
1001201784 5:169724299-169724321 GAGCTGGAGCAGGAGTGGTCAGG + Intronic
1001393391 5:171398950-171398972 AAGCTGAAGCAGGAGGAACCAGG - Intronic
1001962109 5:175885803-175885825 GTCCTGAAGCAGAAGGACCCTGG - Intergenic
1002195101 5:177497121-177497143 GTGCTGAAGAAGGGGAAGGCGGG + Intronic
1007225818 6:40313365-40313387 CTCATGAAGCAGGGGTAGCCTGG - Intergenic
1007314980 6:40979818-40979840 GGGCTGAAGCAGGAGGAAGCTGG - Intergenic
1011718832 6:90134485-90134507 TTAGTGAGGCAGGAGTAGCCTGG + Intronic
1013596024 6:111661908-111661930 GTGCTGGAGCAGGTGGAGCGAGG - Exonic
1014544895 6:122723072-122723094 AAGCTGAAGGAGGAGCAGCCAGG - Intronic
1015552487 6:134426609-134426631 GAGCTGAAGCAGGATTACCAGGG - Intergenic
1016905757 6:149149309-149149331 GTGCTGAGGCAGGAGCAAGCCGG + Intergenic
1019170140 6:170129220-170129242 GAGCCGAAGCAGCAGCAGCCGGG + Intergenic
1019990049 7:4683852-4683874 GTGCTGAAGGAGCAGAGGCCTGG + Intronic
1020591819 7:10148324-10148346 TTGATGAAGCAGGAACAGCCAGG - Intergenic
1021200755 7:17726559-17726581 CTGCTGGAGCATGAGAAGCCAGG + Intergenic
1023153591 7:37225427-37225449 GTGTGGATGAAGGAGTAGCCTGG - Intronic
1025174766 7:56793285-56793307 GTGCTGAAGGAGGGGTTACCAGG - Intergenic
1025697039 7:63783129-63783151 GTGCTGAAGGAGGGGTTACCAGG + Intergenic
1026174541 7:67984903-67984925 GGTCTGAAGCAGGAGTTTCCAGG + Intergenic
1028639630 7:93028626-93028648 GGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1029202983 7:98851483-98851505 ATGCTGAAGCAGTAGTCCCCAGG + Exonic
1031193887 7:118588490-118588512 CAGCTGAAGCTGGAGCAGCCAGG + Intergenic
1034924449 7:155110088-155110110 TTCCTGAAGCAGGTGCAGCCGGG - Intergenic
1035665417 8:1376571-1376593 CTGCTGAAGAAGGGGGAGCCGGG + Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1039019225 8:33186647-33186669 GTGTTGAAGCAGGTGAGGCCAGG + Intergenic
1039792166 8:40884713-40884735 GGACTGAAGCAGGAGCAGCCTGG - Intronic
1039873606 8:41567381-41567403 GTTCTGCAGCAGGAGGAGGCCGG - Intergenic
1041527966 8:58829564-58829586 GTGTTGAAAGGGGAGTAGCCTGG + Intronic
1042030556 8:64471257-64471279 GAGCTGAAGCAGGATTTGGCAGG - Intergenic
1042862669 8:73329770-73329792 GGGCAGAAGCATGGGTAGCCTGG - Intergenic
1044506314 8:93024204-93024226 GTGGGGAAGCAGGAGTAGGCAGG + Intergenic
1045479572 8:102581398-102581420 GAGATGGGGCAGGAGTAGCCTGG - Intergenic
1046216414 8:111153020-111153042 GTGCTGAAGCGGGAGGAAGCTGG - Intergenic
1046918197 8:119699595-119699617 GTTCTGAAGCAGGAGGTGCCTGG - Intergenic
1047024477 8:120811479-120811501 GTGCTGAAGCAGGAGCTGGGCGG - Exonic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049674854 8:143884879-143884901 CTGGTGAGGCAGGAGCAGCCAGG - Intergenic
1053020068 9:34688565-34688587 GGGTGGAAGAAGGAGTAGCCAGG - Intergenic
1053461070 9:38272016-38272038 GTGCTGGAGTAGGAGTAGGTGGG - Intergenic
1057180766 9:93028868-93028890 AGGCTGGAGCAGGTGTAGCCTGG - Intronic
1060679156 9:125546105-125546127 GTGCTGAAGCCAGGGTAGCAAGG + Intronic
1062065714 9:134525202-134525224 GTCCTGAGGCAGCAGGAGCCAGG - Intergenic
1062067676 9:134537452-134537474 GTGCTGGAGCAGGAGTAGTGGGG + Intergenic
1062494135 9:136823694-136823716 GGGCTGAGGGAGGAGAAGCCTGG - Intronic
1191738026 X:64407611-64407633 CAGCTGGAGCAGGAGTGGCCAGG + Intergenic
1192927954 X:75776395-75776417 GTGGTGCAGCAGGAGTGGGCAGG + Intergenic
1193483646 X:82059534-82059556 GAGCTGAAGAAGGAGGAGACTGG + Intergenic
1194435041 X:93859852-93859874 CAGCTGAAGCTGGAGTAGCTGGG - Intergenic
1194817560 X:98462863-98462885 GTGGTGAAGAAGGAGAAGCCGGG - Intergenic
1198325933 X:135573242-135573264 GAGATGAAGCTGGAGTAGGCAGG + Intronic
1201177956 Y:11321452-11321474 GCGCTGCAGCAGGTGCAGCCAGG - Intergenic
1201228900 Y:11844875-11844897 GGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1201650546 Y:16280048-16280070 CTGCTCAAGCTGGAGTAGACTGG + Intergenic