ID: 908412023

View in Genome Browser
Species Human (GRCh38)
Location 1:63876360-63876382
Sequence CAAGTGATGCACAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908412023 Original CRISPR CAAGTGATGCACAGGGTGGG AGG (reversed) Intronic
900018183 1:169071-169093 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900048442 1:527667-527689 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900070668 1:769519-769541 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
901021605 1:6258831-6258853 CAACACATGGACAGGGTGGGCGG - Intronic
901775949 1:11560540-11560562 CAGGTGGGGCAGAGGGTGGGGGG + Intergenic
902980395 1:20118506-20118528 CAAGGGATGGACACAGTGGGTGG + Intronic
903031008 1:20464409-20464431 CCAGTGAGGCCCAGGATGGGAGG - Intergenic
903042459 1:20541676-20541698 GAAGAGATGCATAGGGTGAGGGG + Intergenic
903458702 1:23506132-23506154 CCACTGATGTAGAGGGTGGGAGG + Intergenic
903481220 1:23654750-23654772 TAAGTGAGTCACAGGGAGGGGGG - Intergenic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
905002038 1:34680117-34680139 CTAGGGCTGCACAGGGTGGAGGG + Intergenic
905901237 1:41583184-41583206 CAGGAGAGGCACAGGGGGGGCGG + Exonic
906074909 1:43045031-43045053 CAAGTGCTCCAGGGGGTGGGAGG + Intergenic
906705766 1:47894129-47894151 ACAGTGATACACAGTGTGGGTGG + Intronic
907532960 1:55120261-55120283 AAAGTGATGCACAAGGGGAGAGG + Intronic
907887886 1:58610523-58610545 CAAGGGAGGGACAAGGTGGGAGG - Intergenic
908412023 1:63876360-63876382 CAAGTGATGCACAGGGTGGGAGG - Intronic
910520423 1:88115476-88115498 TAAGTGATGCACAGAACGGGCGG - Intergenic
910553606 1:88504760-88504782 CCAGTTATGCAAAGGCTGGGAGG + Intergenic
911864189 1:102995058-102995080 CCAGGGAGGCACATGGTGGGAGG - Intronic
913127853 1:115809792-115809814 AAAGTGATTGAAAGGGTGGGAGG - Intergenic
915678037 1:157549978-157550000 CATGTGTTGAACAGGATGGGTGG + Intronic
917218542 1:172703117-172703139 GAAGTGACCCACAGGGTAGGAGG + Intergenic
918369514 1:183845595-183845617 GGAGTGATGAAAAGGGTGGGTGG - Intronic
920174006 1:204088947-204088969 CCAGTGGTCCAGAGGGTGGGAGG + Intronic
921739338 1:218666121-218666143 CAACATATGAACAGGGTGGGAGG - Intergenic
922106029 1:222514934-222514956 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
923846089 1:237734411-237734433 CAAGGGAGGGACAAGGTGGGAGG - Intronic
1062842850 10:684623-684645 CAAGAAATGCACAGGGCTGGGGG + Intronic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063107440 10:3004813-3004835 CAAGTGTTGGAGAGGGTGTGGGG - Intergenic
1063609878 10:7553293-7553315 CGAGTAGGGCACAGGGTGGGGGG + Intergenic
1063724531 10:8622240-8622262 CAAGTTATGCAGTGAGTGGGTGG + Intergenic
1063846366 10:10132099-10132121 CAAGTGGTTCACATAGTGGGTGG + Intergenic
1064238493 10:13601515-13601537 CAAGTGAAGAACTGGGTAGGAGG - Intronic
1065889810 10:30111182-30111204 CAGGTGAGGAACAGGGTGGAAGG - Intronic
1065991533 10:31014671-31014693 CAAGTGAGGCACTGGGAGGTTGG - Intronic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066728150 10:38412399-38412421 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1067091490 10:43267775-43267797 AAACTGATGCACAGGGAGTGCGG + Intergenic
1070355857 10:75639652-75639674 CATCTGAAGCACAGGGCGGGAGG - Intronic
1074181829 10:111072169-111072191 CAAATGATGAACATGGTAGGTGG + Intergenic
1074265090 10:111893718-111893740 GAAGGGATGCACATGGTGTGAGG - Intergenic
1074888146 10:117710994-117711016 CTAGTGATGCTCAGGGTATGGGG + Intergenic
1075042444 10:119119051-119119073 CAAGTGTTGCCTAGGCTGGGTGG + Intronic
1076004673 10:126939026-126939048 GAAGGGATGAACACGGTGGGGGG + Intronic
1076974786 11:164267-164289 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1077393389 11:2309922-2309944 CAAATGATGCCAGGGGTGGGTGG - Intronic
1082081199 11:48013752-48013774 CATGTGATGCACCCTGTGGGCGG + Intronic
1084425135 11:69080318-69080340 AAAGTGATGTCCAGAGTGGGAGG - Intronic
1084667295 11:70583250-70583272 CAACTGATGCAAGAGGTGGGAGG + Intronic
1085361259 11:75889584-75889606 CAAATAATGCACAGGGTTGTTGG - Intronic
1086146949 11:83562396-83562418 CCTGTGATGCCCTGGGTGGGGGG + Intronic
1089240919 11:117078358-117078380 CGTGTCATGCACAAGGTGGGAGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089502175 11:118939176-118939198 GCAGTGATGCAGTGGGTGGGTGG - Intronic
1089681173 11:120119796-120119818 CCAGCCATGCACAGGGAGGGAGG - Intronic
1090333489 11:125948183-125948205 GAAGGGATGGTCAGGGTGGGTGG + Intergenic
1091214371 11:133891602-133891624 CCAGTGATGAGCAGGGTGGGAGG + Intergenic
1091581481 12:1793123-1793145 AAAGTGAGGCTCATGGTGGGAGG - Exonic
1097291973 12:57924807-57924829 CAAGTGAGGGACTTGGTGGGAGG - Intergenic
1098188381 12:67922613-67922635 CAAGTTCTACACATGGTGGGAGG + Intergenic
1100674083 12:96847338-96847360 CAAGTAGAGCACAGGGAGGGAGG - Intronic
1103516079 12:121509352-121509374 TAAGAGCTGCAGAGGGTGGGTGG - Intronic
1103783575 12:123415630-123415652 GAAGGGATGTGCAGGGTGGGGGG - Exonic
1103940415 12:124498437-124498459 CATGTGAGGCGCTGGGTGGGGGG - Intronic
1105256071 13:18744725-18744747 ACAGTGCTGCCCAGGGTGGGTGG - Intergenic
1105759563 13:23501630-23501652 CAAGCGATGCCCAGGGAAGGAGG - Intergenic
1106433357 13:29703292-29703314 CAAGTCCTGCCCAGGGTGGATGG - Intergenic
1108118388 13:47155969-47155991 CATGGGAGGCACTGGGTGGGAGG + Intergenic
1113037046 13:106062039-106062061 GCAGGGAGGCACAGGGTGGGCGG - Intergenic
1115175419 14:30556881-30556903 CAAGTGATGGCCAGGCTGCGGGG + Intergenic
1116503686 14:45651835-45651857 CTAGTGATGGACATGGAGGGAGG - Intergenic
1120722530 14:87904387-87904409 AAAGAGAAACACAGGGTGGGAGG + Intronic
1122202830 14:100132894-100132916 CAGGTGATTCACAGGAGGGGCGG + Intronic
1122806726 14:104263462-104263484 CACCTGAAGGACAGGGTGGGGGG + Intergenic
1122839250 14:104447036-104447058 AAAATGAAGCCCAGGGTGGGAGG - Intergenic
1122869786 14:104633027-104633049 CAAGTTATGCACAGGGTGTGTGG - Intergenic
1123408401 15:20038495-20038517 CAAGGGATGGACCTGGTGGGAGG + Intergenic
1123517725 15:21045136-21045158 CAAGGGATGGACCTGGTGGGAGG + Intergenic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1131115318 15:89791789-89791811 CATATGAGGCACATGGTGGGAGG + Intronic
1132607690 16:800394-800416 CACGGGGTGCACGGGGTGGGTGG - Intronic
1132992931 16:2806423-2806445 CAACGCATGCACAGGGTAGGAGG - Intergenic
1134190986 16:12121151-12121173 CAAGTGACCCACAGGCTTGGGGG + Intronic
1136003962 16:27315609-27315631 AAAGGGAGGCACAGAGTGGGCGG + Intronic
1136139846 16:28281552-28281574 CAGCTGATGGACAGGCTGGGTGG + Intergenic
1138092024 16:54182551-54182573 TAACTGATGCACAGAGTGAGGGG - Intergenic
1138342227 16:56297472-56297494 CATGTCATCCACCGGGTGGGTGG - Intronic
1139160024 16:64493911-64493933 CATGTGATCCCCAGTGTGGGAGG + Intergenic
1140757158 16:78078052-78078074 CTATTGATGCACAGTGAGGGTGG + Intergenic
1141448886 16:84083269-84083291 CAAGTGAGGAACAGAGTGGAGGG - Intronic
1142066160 16:88064288-88064310 CAAGGGACGCACAGGGTGCTGGG - Intronic
1142445477 16:90133390-90133412 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1142462035 17:102080-102102 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1142495584 17:304914-304936 CAAGAGAGGCACAGGGCGAGAGG + Intronic
1142687425 17:1585825-1585847 CATGTCAGGCACAGGGTGGGTGG - Intronic
1143104792 17:4523808-4523830 CAAGTGCTACAGAGGGTGGGAGG - Intronic
1144054756 17:11530029-11530051 CTAGTGCTGCTCAGGGTGAGGGG + Intronic
1146127961 17:30243873-30243895 AAAGTGCGGGACAGGGTGGGAGG + Intergenic
1150910388 17:69381578-69381600 CAAGTGATGCTAAGGGTCGCCGG - Intergenic
1152246169 17:79185652-79185674 CAAATGATTCACAGGCAGGGTGG - Intronic
1153914105 18:9730781-9730803 GAAGTTCTGCACAGGGTGGCTGG + Intronic
1154434961 18:14335953-14335975 ACAGTGCTGCCCAGGGTGGGTGG + Intergenic
1156211023 18:34943054-34943076 CAAATGAGGCACAAGGTAGGAGG - Intergenic
1156436834 18:37139980-37140002 TAAGTAATGCAGAGGGTAGGAGG + Intronic
1158630757 18:59112102-59112124 GAAGGGATGCACAGGGAGGGGGG - Intergenic
1158696768 18:59710485-59710507 GAAGGGATGCACTGGGTGGCTGG - Intergenic
1159021320 18:63145383-63145405 CAAGAGATCCAGGGGGTGGGGGG + Intronic
1159420977 18:68219177-68219199 CAAGGGAGGGACATGGTGGGAGG - Intergenic
1160651738 19:234448-234470 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1160665752 19:327385-327407 CAAAGGGTGCACAGCGTGGGGGG + Intronic
1160734146 19:654158-654180 CCACTGAAGCACAGGCTGGGTGG + Intronic
1161261183 19:3338693-3338715 CCAGGGTGGCACAGGGTGGGCGG + Intergenic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161492553 19:4570230-4570252 CAAGTTATTCCCAGGGTGGGAGG - Intergenic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1164785216 19:30925151-30925173 TTAGGGATGCTCAGGGTGGGAGG + Intergenic
1165421783 19:35725635-35725657 CAAGGGCTGGCCAGGGTGGGTGG + Intronic
1165436417 19:35797676-35797698 GAAGAGAAGGACAGGGTGGGAGG + Intergenic
1167342742 19:48925469-48925491 CCAGGGATGGGCAGGGTGGGGGG + Intergenic
1167932539 19:52878218-52878240 AAAGTGATGCACAGAGTGGCAGG - Exonic
1168250847 19:55141131-55141153 CAAGGGATCCACATGGAGGGAGG + Intronic
1168329920 19:55561994-55562016 CAAGGGATGCCAAGGGTGGCTGG + Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925807104 2:7661281-7661303 CATGTGATGCTCATTGTGGGTGG - Intergenic
926096028 2:10080750-10080772 CTAGCGATGCGCGGGGTGGGCGG + Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
929969859 2:46564781-46564803 CAAGTGTTGAAAAGGGTGAGAGG + Intronic
932420787 2:71600066-71600088 CAAGTGCAGAACAGGGCGGGAGG + Intronic
932495099 2:72142233-72142255 CAAGTCAGGCCCAGGGTGGGTGG + Intronic
933360944 2:81283158-81283180 CAAGCCCTGCACAGTGTGGGAGG + Intergenic
933402607 2:81818413-81818435 CAAGTGAGAGAAAGGGTGGGTGG + Intergenic
933425728 2:82109861-82109883 CAAGGGAGGGACACGGTGGGAGG - Intergenic
933811512 2:86035660-86035682 CAAAGGGTGCACAGGGTGGAGGG - Intronic
934491080 2:94762353-94762375 AAGGTGTTGCCCAGGGTGGGTGG - Intergenic
935489490 2:103698820-103698842 TAGGAGCTGCACAGGGTGGGCGG - Intergenic
935558815 2:104540153-104540175 CAAGTGATCCACAGGAAGGCAGG - Intergenic
936014750 2:108949541-108949563 CAAGTCATGCACTGGTTTGGAGG - Intronic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
937039758 2:118812117-118812139 CAAGTATTGCCCAGGGTGTGGGG - Intergenic
937808200 2:126170009-126170031 CAAGTGATTGGCAGGGTGAGCGG + Intergenic
940005969 2:149009935-149009957 CACGTGATTCACAGGGTGCAAGG - Intronic
940755231 2:157674356-157674378 CAAGTGAGGCAAAGGTTGGGAGG - Intergenic
941014005 2:160333696-160333718 AAAGTGAAGTACAGGATGGGTGG + Intronic
943462295 2:188184264-188184286 GGAGTGATTCACATGGTGGGTGG + Intergenic
945213612 2:207410118-207410140 GAAATGATGCACAGCTTGGGGGG + Intergenic
946371687 2:219285184-219285206 CTGGTGAAGCCCAGGGTGGGGGG + Exonic
947740046 2:232480846-232480868 GAAGCGGTGCCCAGGGTGGGCGG - Intronic
948098376 2:235354537-235354559 CAAGTGAAGCCAGGGGTGGGAGG - Intergenic
1170507990 20:17048211-17048233 CAAGTGAAGCCCTGGGTGAGTGG + Intergenic
1171181941 20:23097530-23097552 CAAGTGATGGGCAGGTTGGAGGG + Intergenic
1171437581 20:25135216-25135238 TAAATGATGCAAAGTGTGGGAGG - Intergenic
1174179763 20:48667473-48667495 GAAGTGATGCTCAGGATGGTGGG + Intronic
1178219299 21:30637827-30637849 CAAGGGAAGGACGGGGTGGGAGG + Intergenic
1178977379 21:37231565-37231587 CAAGTGAAGGACAAGCTGGGAGG - Intronic
1183232337 22:36590831-36590853 GCAGAGATGCACAGGGAGGGAGG - Intronic
1183363624 22:37395812-37395834 CAAGGGAGGCCCAGGGTGGGAGG + Intronic
1183698302 22:39435704-39435726 CATGTGATGCCCAGTGTGTGCGG - Intronic
1184175770 22:42788050-42788072 CAAGTGCAGCACATGGTGGGAGG + Intergenic
949933580 3:9099514-9099536 CATGTGCTGCACCAGGTGGGAGG - Intronic
950799620 3:15539520-15539542 CAAGTGAGGTTCAGTGTGGGAGG - Intergenic
951255756 3:20447654-20447676 CAAGTGAGGCCCAGGCAGGGGGG - Intergenic
954121191 3:48501105-48501127 CCAGTGGGTCACAGGGTGGGTGG - Intronic
954367118 3:50152081-50152103 CAAGGAGAGCACAGGGTGGGGGG + Intergenic
954912918 3:54123200-54123222 CAGGTGATGCCCAGTTTGGGGGG + Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955877562 3:63508797-63508819 TAAGGGATGAAGAGGGTGGGTGG - Intronic
956109470 3:65856092-65856114 CAACTGAGGGACTGGGTGGGAGG + Intronic
959577135 3:107946663-107946685 CAAGGGAGGGACAAGGTGGGAGG - Intergenic
960068620 3:113403258-113403280 AAAGTGCTACACAGAGTGGGTGG + Intronic
961768647 3:129231881-129231903 CCAGGGTGGCACAGGGTGGGAGG + Intergenic
962186514 3:133266154-133266176 CAAGTGATGATAAGGCTGGGTGG - Intronic
964855765 3:161143849-161143871 CAAGGGATGGACCTGGTGGGAGG - Intronic
968350157 3:198046804-198046826 ACAGTGCTGCCCAGGGTGGGTGG + Intergenic
968366093 3:198185520-198185542 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
969589341 4:8112842-8112864 CAGGTGATGGAAGGGGTGGGAGG - Intronic
970076882 4:12232474-12232496 TAAGAGATGCACAGGCTTGGGGG - Intergenic
970213197 4:13732139-13732161 CCAGGGATGCCCTGGGTGGGAGG - Intergenic
973533021 4:51851655-51851677 CAGGTGGGGCACAGGGAGGGAGG + Intronic
974156755 4:58083433-58083455 CAAGTGAAGGACAGAGTGGGAGG + Intergenic
975616521 4:76252261-76252283 CAAGTGGAGCCCAGGGTTGGGGG + Intronic
975875220 4:78828308-78828330 GAAGTGATGCATAGGGTATGAGG + Intronic
976104741 4:81604709-81604731 CAATTAATGGACAGTGTGGGTGG - Intronic
976678890 4:87733278-87733300 CAAGTGAGGGACCTGGTGGGAGG - Intergenic
977404118 4:96574571-96574593 CAAATGAAACACAGTGTGGGGGG + Intergenic
978618239 4:110615992-110616014 CAAGTGAACAACATGGTGGGAGG + Intergenic
979333826 4:119445334-119445356 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
982302567 4:153894764-153894786 CAAGGGATGGACATGGTGGGAGG - Intergenic
982338855 4:154272460-154272482 CAAGGGAGGCACCAGGTGGGAGG + Intronic
986869376 5:12029156-12029178 CAAGGGAGGCACTTGGTGGGAGG - Intergenic
988761020 5:34309955-34309977 CAAGGGAGGGACATGGTGGGAGG - Intergenic
990000888 5:50891449-50891471 CAAGGGAGGGACATGGTGGGAGG - Intergenic
990479196 5:56191707-56191729 AAAGTGAAGCACAGTGTAGGGGG + Intronic
990797851 5:59564828-59564850 AAAGTGATGCACAGGTTGCAGGG + Intronic
991386849 5:66100646-66100668 CAAGTGAAATACAGGGTTGGAGG + Intergenic
994153726 5:96478947-96478969 GAAGTGGTGCATAGGGTAGGAGG + Intergenic
996071618 5:119137560-119137582 CAAGGGAGGCACCTGGTGGGAGG + Intronic
997303623 5:132823674-132823696 CTGGTCAAGCACAGGGTGGGTGG + Exonic
997587592 5:135052714-135052736 CTAGTGATGCCCAGGGGTGGTGG + Intronic
999384733 5:151146061-151146083 CAAGTGAGTCCCAGGGTGGCAGG - Intronic
999654821 5:153801321-153801343 CAACTGATGGTCATGGTGGGAGG - Intronic
1000565288 5:162839635-162839657 CAAATGAAGCAGTGGGTGGGGGG - Intergenic
1001143055 5:169161352-169161374 GCAGTGATGGACAGGGTGGGAGG - Intronic
1001189537 5:169615577-169615599 CAAGGGAGGGACAAGGTGGGTGG + Intergenic
1002304322 5:178274389-178274411 CAAGGAATGCATGGGGTGGGGGG + Intronic
1002725319 5:181290745-181290767 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1004141988 6:13026654-13026676 TGTGTGATTCACAGGGTGGGAGG + Intronic
1004685939 6:17943829-17943851 CAACTGATGCTCATGCTGGGTGG - Intronic
1004890628 6:20097231-20097253 AAACTGAGGCTCAGGGTGGGTGG - Intergenic
1005106704 6:22231694-22231716 CAAGTGATTCACTGAGGGGGTGG + Intergenic
1005162789 6:22883809-22883831 CAAGTGATGGAAAGGGAGGGTGG - Intergenic
1005919028 6:30382281-30382303 CAAAAGAGGAACAGGGTGGGAGG + Intergenic
1006860425 6:37168961-37168983 CAAGGGAGGCAGAGGGTGGGGGG + Intergenic
1007189293 6:39999680-39999702 CAACTGATGGACAGAGAGGGTGG - Intergenic
1008211476 6:48729751-48729773 CTGGTGATGATCAGGGTGGGTGG - Intergenic
1008261125 6:49367508-49367530 CAAGGGAGGGACATGGTGGGAGG - Intergenic
1008509408 6:52262305-52262327 AAACTGAGGCACAGAGTGGGGGG - Intergenic
1009734628 6:67661206-67661228 AAAGTGAGGCACAGAATGGGGGG + Intergenic
1010376496 6:75176423-75176445 AAAGTGATGCAGTGGGAGGGAGG + Intronic
1011775626 6:90727474-90727496 CAAGGGAGGGACATGGTGGGAGG + Intergenic
1011810326 6:91124751-91124773 CAAGTGATTTACAGAGTGGAGGG + Intergenic
1012213631 6:96556165-96556187 CATGGGAAGAACAGGGTGGGAGG - Intergenic
1014187172 6:118448053-118448075 CATGGGAGGGACAGGGTGGGAGG - Intergenic
1014293867 6:119594109-119594131 CATGTGAGGCACGGGGAGGGAGG + Intergenic
1014814028 6:125916080-125916102 CAAGGGAGGCACCTGGTGGGAGG + Intronic
1015219147 6:130784315-130784337 CAAGGGAGGCACCTGGTGGGAGG + Intergenic
1016889692 6:148993751-148993773 CAAGTGAGGCTCAGGGGAGGAGG - Intronic
1016974196 6:149791006-149791028 CTACTGAGGCACAGTGTGGGGGG + Intronic
1017762772 6:157583962-157583984 CCAGTGATGAGCAGGGTGGGTGG + Intronic
1019101757 6:169636341-169636363 AAAATAATGCACAGGGCGGGGGG + Intronic
1024070225 7:45778358-45778380 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1024232893 7:47376212-47376234 CAAGAGATGGAAAGGGTGGTGGG + Intronic
1024285935 7:47757632-47757654 CAGGTGAAGCAAATGGTGGGTGG + Intronic
1025099208 7:56121586-56121608 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1028536696 7:91896130-91896152 CAAGTGATGGAGAAGGTGGGAGG + Intergenic
1028616063 7:92768142-92768164 CAAGGGATGCTGAAGGTGGGAGG + Intronic
1029222020 7:98997897-98997919 CAAGTGATCCACAGTGTTTGTGG + Intronic
1029593246 7:101521234-101521256 CAAGGGAGGGACACGGTGGGAGG - Intronic
1031376286 7:121030528-121030550 CAAGTGACTCAAAGGGTAGGGGG - Intronic
1031435764 7:121729948-121729970 CAAGGGAGGGACATGGTGGGAGG - Intergenic
1031800804 7:126242397-126242419 CAAGTGAGGGACCTGGTGGGAGG + Intergenic
1032047627 7:128622650-128622672 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1033269321 7:139916496-139916518 CATGTGATGGACGTGGTGGGTGG + Intronic
1034987868 7:155528525-155528547 CAAGTCCAGCAGAGGGTGGGTGG + Intronic
1037625744 8:20605383-20605405 CATGTGGTGGACAGGGTGAGGGG - Intergenic
1037974566 8:23200341-23200363 CTAGGGTTGCACAGGATGGGAGG + Intronic
1039569823 8:38577784-38577806 CCAGTGCTGAACAGGTTGGGAGG + Intergenic
1042900916 8:73726561-73726583 AAAATGAAGCACAGGGTGGAAGG - Intronic
1044428297 8:92079979-92080001 AGAATGATGCAGAGGGTGGGGGG - Intronic
1046813425 8:118557134-118557156 CAAGGGAAGGACCGGGTGGGAGG + Intronic
1046839642 8:118842199-118842221 CAAGGGATGGACCTGGTGGGAGG + Intergenic
1047237233 8:123052516-123052538 CAAGAGCTGCTCTGGGTGGGGGG - Intronic
1049353723 8:142177567-142177589 CAAGTGATGGGCAGGGTCTGAGG + Intergenic
1051267512 9:15323195-15323217 CAAGTGATGCACACAGTAGGGGG - Intergenic
1054918959 9:70522745-70522767 GAAGAGATGCATAGGGTGTGGGG + Intergenic
1057058610 9:91983277-91983299 CCACTGAGGGACAGGGTGGGGGG - Intergenic
1057786066 9:98088021-98088043 CAAGGGACGCACCTGGTGGGCGG + Intronic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1058857096 9:109073179-109073201 CATGTAATACAGAGGGTGGGAGG - Intronic
1061924628 9:133799983-133800005 CAAGTGATGCCCAGTGTGTGTGG - Intronic
1062623476 9:137433003-137433025 CAAGAGAAGCACAGGCTGGGTGG - Intronic
1062750462 9:138248387-138248409 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1185670115 X:1802237-1802259 AAAGTCAAGCACAGGGTGTGTGG - Intergenic
1187616905 X:21005656-21005678 AAAGTGTTGCAGAGGGTGAGGGG + Intergenic
1189650985 X:43189246-43189268 CAAGAGAGGGACATGGTGGGAGG - Intergenic
1190277080 X:48905573-48905595 CAATGGAGGGACAGGGTGGGGGG + Intronic
1190732193 X:53233641-53233663 CCATTGATGCACTTGGTGGGTGG - Exonic
1195456126 X:105072067-105072089 CAAGGGAGGGACTGGGTGGGAGG + Intronic
1197951370 X:131901100-131901122 CATTTAATGCACAGGGTGTGGGG + Intergenic
1201472499 Y:14349731-14349753 CCAGTGAAGCAAAGGGTTGGGGG - Intergenic
1201698205 Y:16851354-16851376 CAAGTGTTGGACAGGATGTGGGG - Intergenic