ID: 908413158

View in Genome Browser
Species Human (GRCh38)
Location 1:63886632-63886654
Sequence CTTCTCCTTCAGAATGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908413156_908413158 16 Left 908413156 1:63886593-63886615 CCTGGCACTTACTAACTGAGGTT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG 0: 1
1: 0
2: 5
3: 55
4: 348
908413154_908413158 28 Left 908413154 1:63886581-63886603 CCACACTCAGTTCCTGGCACTTA 0: 1
1: 0
2: 4
3: 51
4: 441
Right 908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG 0: 1
1: 0
2: 5
3: 55
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908413158 Original CRISPR CTTCTCCTTCAGAATGTTGA AGG Intronic
902037595 1:13468792-13468814 CTCCTCCTTCAGAATCCTGGTGG - Intergenic
902327956 1:15714946-15714968 CTTGTCCTTCAGTAGGCTGATGG + Intronic
904205363 1:28851297-28851319 ATTTTCCATCAGAATTTTGAAGG - Intronic
904224252 1:29001643-29001665 ATTTGCCTTCAGAATTTTGAAGG + Intronic
906087151 1:43145565-43145587 CTTCTACTTCAGAATGGGAAAGG + Intronic
907876256 1:58491106-58491128 CTTTTCTTTAAGTATGTTGAAGG - Intronic
908280007 1:62523490-62523512 TTTCTGTTTCAGAATTTTGAAGG - Intronic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
911172829 1:94787321-94787343 CTTCTCCTTCAATATTTTGTTGG - Intergenic
911432295 1:97806604-97806626 ACTCTGATTCAGAATGTTGATGG - Intronic
912032711 1:105269437-105269459 CTTCTCCTTAAGTATGGTGAAGG + Intergenic
913078695 1:115361762-115361784 CTTTTCTTTAAGAATGTTGAGGG - Intergenic
913431060 1:118790916-118790938 CTTTTCTTTAAGAATGTTGAGGG - Intergenic
913709650 1:121469887-121469909 ATTTTCTTTCAGAATGTTGGAGG + Intergenic
914211445 1:145583134-145583156 CTTTTCTTTAAGAATGTTGAAGG - Intergenic
914276649 1:146130561-146130583 CTTTTCTTTAAGAATGTTGAAGG - Intronic
914366165 1:146980613-146980635 CTTTTCTTTAAGAATGTTGAAGG + Intronic
914486279 1:148112812-148112834 CTTTTCTTTAAGAATGTTGAAGG - Intronic
914537694 1:148581516-148581538 CTTTTCTTTCAGAATGTTGAAGG - Intronic
914628231 1:149483829-149483851 CTTTTCTTTAAGAATGTTGAAGG + Intergenic
914789609 1:150865947-150865969 ATTTTCCCTCAGAATTTTGAAGG + Intronic
915268897 1:154738328-154738350 ATTTTCCTCCAGAATTTTGAAGG - Intronic
916636005 1:166669237-166669259 CATCACCTACAGATTGTTGAAGG + Intergenic
917773896 1:178312387-178312409 AATTTCCTTCAGAATTTTGAGGG - Intronic
919635760 1:200001617-200001639 CTTTTCCTGCAGTATGGTGAAGG + Intergenic
920357724 1:205387183-205387205 GTTCTCCTGCAGTATGTAGAAGG + Intronic
921166196 1:212509034-212509056 GTTTTCCTTCAGAATTTTGAAGG + Intergenic
921742297 1:218699425-218699447 ATTTTCCTTCAGAATTTTGAAGG + Intergenic
922490036 1:226008849-226008871 CTTCTTATTCAGAATGATGTAGG - Intergenic
922616127 1:226962174-226962196 TTTCTCCTTCAGTTTGCTGAGGG + Intronic
923619009 1:235562259-235562281 CTTCTCCTTCAGTATTTTATTGG + Intronic
1063192110 10:3705317-3705339 CTTTTCTTTCAGACTGTTGGGGG + Intergenic
1063446650 10:6122309-6122331 ATTTTCCCTCAGAATTTTGAGGG + Intergenic
1063564878 10:7163900-7163922 CTTTTCCTGCAGGATATTGACGG - Exonic
1063590996 10:7395313-7395335 GTCCTCCCTCAGAATCTTGAGGG + Intronic
1065277712 10:24102579-24102601 CTTCTCCTTCAATATGGTGTTGG - Intronic
1066133660 10:32420169-32420191 CTTCTCTTTCAAAATTTTGCTGG + Intergenic
1066988275 10:42487573-42487595 CTTTTTCTTCAAAATGATGAGGG - Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067249374 10:44574338-44574360 CTTCACTCTCAAAATGTTGAAGG - Intergenic
1069185091 10:65412440-65412462 ATTGTCCTTCATAATGTGGATGG + Intergenic
1069740262 10:70682832-70682854 CTTCTCCTTCAGTTTGCTGCTGG + Intronic
1069899753 10:71700712-71700734 CTTCTCCTTCAGAGAGGTGGGGG - Intronic
1069991742 10:72320502-72320524 CTTCTCTTTAAGAATCTTCATGG - Intergenic
1070245226 10:74724792-74724814 CTTGTCCTTCAGTAGGTTAATGG + Intergenic
1070434661 10:76378485-76378507 CTCCTCATTCAGTATGATGATGG + Intronic
1070620594 10:78007167-78007189 ATTTTCCCTCAGAATTTTGAAGG - Intronic
1071851701 10:89578715-89578737 ATTTTTCTTCAGAATTTTGAAGG - Intergenic
1072323929 10:94277484-94277506 CTTCTCCTTGAGCATCTTGGGGG + Intronic
1072772850 10:98157051-98157073 ATTTTTCTTCAGAATTTTGAAGG + Intronic
1073525497 10:104177842-104177864 GTTTGCCTTCAGAATGTTGAAGG - Intronic
1076330442 10:129660572-129660594 CTTCCTCTTCAGCATGCTGAGGG + Intronic
1077482602 11:2823277-2823299 ATTTTCCTTCACAATTTTGAAGG - Intronic
1080058992 11:27937111-27937133 CTTATCCCTCAGACTGTTGGAGG - Intergenic
1082792123 11:57353353-57353375 CTTCTCCTTTATAAAGTTGGGGG - Intronic
1083152689 11:60802768-60802790 GTTGTCTTGCAGAATGTTGATGG + Intergenic
1083246656 11:61433663-61433685 ATTCTCATCCAGAATGTTTATGG + Intronic
1085126236 11:74004509-74004531 CTTCTCCTTGAGGATGTCGTAGG + Exonic
1085694421 11:78691928-78691950 CTGCTCCTTCTGACTGTGGATGG + Intronic
1085812947 11:79702140-79702162 CTTTTCTTTAAGAAGGTTGAAGG - Intergenic
1086232701 11:84589540-84589562 ATTCTCCTAGAGAATATTGAGGG + Intronic
1086471247 11:87114008-87114030 ATTTTCCTTCAGAATTGTGAAGG - Intronic
1087689645 11:101305311-101305333 CTACTCCATCAGAATTTTGGAGG - Intergenic
1087821096 11:102713304-102713326 ATCCACTTTCAGAATGTTGAAGG - Exonic
1088783185 11:113155881-113155903 CGTCTCCATCAGCAAGTTGAGGG - Intronic
1089723855 11:120455429-120455451 ATTTTCCTTCAGAAAGTTGAAGG - Intronic
1089861496 11:121594035-121594057 ATTTTCCTTCAGAGTTTTGAAGG + Intronic
1090063258 11:123481799-123481821 CTTTGCCTACAGAAAGTTGATGG + Intergenic
1091168852 11:133503010-133503032 CTTCTCCTTATTAATATTGATGG + Intronic
1091939051 12:4459203-4459225 CTTCTCCTTCAATATTTTGTCGG - Intergenic
1093286536 12:17270469-17270491 AGTTTCCTTCAGAATGTTGAGGG + Intergenic
1093837120 12:23846183-23846205 TTTCTCTTTCAGGAAGTTGATGG - Exonic
1093914210 12:24782666-24782688 CTTCTCCTCCAGAAAATTTAAGG - Intergenic
1094747101 12:33357492-33357514 CTTCTGCTTGAGAATGCTGCAGG - Intergenic
1094804251 12:34072844-34072866 CTTTTCTCTAAGAATGTTGAGGG - Intergenic
1094814495 12:34169773-34169795 TTTCTCCTTGAGAGTATTGAAGG + Intergenic
1095102426 12:38198809-38198831 TTTCTCCTTTAGAGTATTGAAGG - Intergenic
1095796728 12:46227153-46227175 ATTTTCCTTCAGAATTTTGAAGG - Intronic
1096107907 12:49008726-49008748 GTTTTCCTGCAGAATGTTGAAGG + Intronic
1096921695 12:55094089-55094111 TTTCTCCCTAAGAATGTTCATGG - Intergenic
1098896852 12:76072776-76072798 ATTTTTCTTCAGAATTTTGAAGG - Intronic
1099202878 12:79695393-79695415 ATTTTCCTTCATAATTTTGAAGG + Intergenic
1100042803 12:90341402-90341424 CTTGTCCTTCAGACTCTAGAAGG - Intergenic
1101872537 12:108577799-108577821 CTTCTACATAAGAATTTTGAGGG - Intergenic
1102427441 12:112855264-112855286 CTTCTCTCCCAGATTGTTGATGG + Intronic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG + Intergenic
1110703701 13:78579954-78579976 CTTCAGCTTCACTATGTTGATGG - Intergenic
1112048843 13:95624630-95624652 CTTCTCCCTGAGAGTCTTGAGGG - Intronic
1112281002 13:98063159-98063181 GATCTTCTTGAGAATGTTGAGGG + Intergenic
1112685205 13:101816381-101816403 CTTCTCTTTCACCATGTTGGCGG - Intronic
1115148240 14:30252263-30252285 CTTTTCCCTAAAAATGTTGATGG + Intergenic
1115168901 14:30480498-30480520 ATTTTCCCTCAGAATTTTGAAGG - Intergenic
1116757613 14:48967132-48967154 CTTATCTTTTAGAATGTTTATGG + Intergenic
1117301745 14:54436952-54436974 CTTCTCCCTGAGAGTGTAGAGGG - Intronic
1118823252 14:69358599-69358621 CTTCTCCTTCTGAAGGATGCTGG + Intergenic
1119153321 14:72385955-72385977 GTTCTCCTTCAGAATATTCAAGG - Intronic
1119583201 14:75806373-75806395 CTTCTGCTTAAGAATCTCGAGGG + Intronic
1120305398 14:82763380-82763402 CATCTCCCTCACAATGTTGTTGG - Intergenic
1120576273 14:86185314-86185336 CTTCTCTCTCAGAATGCAGATGG + Intergenic
1121160084 14:91730096-91730118 TTTCAACTTCAGAATTTTGAGGG - Intronic
1121356985 14:93223743-93223765 CTTCACCTTCAGGATCTCGATGG + Intronic
1121856498 14:97275059-97275081 CTTCTCCTTGATACTGATGATGG - Intergenic
1122188345 14:100019527-100019549 CTTTTACTTCAGAATATTGGGGG + Intronic
1122901249 14:104783209-104783231 CTTCTCCTTCACTATCCTGAGGG + Intronic
1124068272 15:26366593-26366615 GTCCTCCTTCAGAATTTTAAGGG + Intergenic
1124119807 15:26879331-26879353 CTTCTTCTTCAGAGTTTTGCAGG - Intronic
1124398401 15:29326748-29326770 CTTCTCCTTTAGCATTTTGTTGG - Intronic
1124783836 15:32660487-32660509 CTTCTCCATCAGAATAGTGCTGG - Intronic
1125163862 15:36679739-36679761 CTTCTCCTTGAAAAGGTTGGTGG - Intronic
1125419623 15:39491482-39491504 CTTCTAGTTGAAAATGTTGATGG - Intergenic
1127202925 15:56677150-56677172 ATTCTCCTTTAGATTGTTAATGG + Intronic
1128488834 15:68125609-68125631 ATTTTCCTTTAGAATTTTGAAGG + Intronic
1128790519 15:70430079-70430101 CATCTCCTTCAAAATGAGGATGG - Intergenic
1128900108 15:71412743-71412765 CTCCTCATTCAAAATGTTGTTGG - Intronic
1128941017 15:71787688-71787710 CTCACCCTTCAGAATGCTGAGGG + Intergenic
1129223925 15:74154626-74154648 ATTTTCCCTTAGAATGTTGAAGG + Intergenic
1129736536 15:77968863-77968885 ACTCTTCTTCAGAATGTTGAAGG + Intergenic
1129849545 15:78784801-78784823 ACTCTTCTTCAGAATGTCGAAGG - Intronic
1130033418 15:80336037-80336059 TTACTCTTTCAGAATGCTGAAGG - Intergenic
1130252718 15:82310876-82310898 ACTCTTCCTCAGAATGTTGAAGG + Intergenic
1131585738 15:93690879-93690901 CTTTTCCTCCAGTATATTGATGG + Intergenic
1132255929 15:100375625-100375647 GTTCTCCTTCAGTATTTTTATGG + Intergenic
1133838086 16:9384126-9384148 CTTCTCCTTCAGCACTGTGACGG + Intergenic
1135831154 16:25774789-25774811 TTTCACCTTCAGAATCTTGATGG + Intronic
1136021457 16:27443046-27443068 CTTGCCCTTCAGCATGTAGAAGG - Exonic
1137022274 16:35440550-35440572 CTTGGCCTTCAGTGTGTTGATGG - Intergenic
1137892463 16:52176892-52176914 CTTCTGCTTCAGGATGGTAAGGG + Intergenic
1139841529 16:69885144-69885166 CTTCTTCTTTAGAATGTTCATGG + Intronic
1142305498 16:89282165-89282187 CTTCTCTTTTAGGATGTTGATGG + Exonic
1145296030 17:21593260-21593282 CTTCTCCTCCAAGCTGTTGAGGG - Intergenic
1146028191 17:29341435-29341457 CTTCTCCTTCAGTATTGTGTTGG - Intergenic
1146999203 17:37348525-37348547 ATTTTCCTTCAGAATTTTGAAGG - Intronic
1148249761 17:46066231-46066253 ATTCTCCTTCAAAGTGTTAAGGG + Intronic
1148534027 17:48423269-48423291 CTTCTCCTTCACAAAACTGAAGG + Intronic
1149413990 17:56439133-56439155 CCTCTTCTTCAGAATGTTCCTGG - Intronic
1151653646 17:75485468-75485490 CTGCTCCTTCAGGACGCTGAGGG - Exonic
1151748738 17:76025081-76025103 TTTCTCCATCAGAAAGATGATGG + Intronic
1153499550 18:5734151-5734173 CTGATCCTTCAGAAAGATGATGG + Intergenic
1153538408 18:6128598-6128620 CTTTTCCTTCAGAATATTGAAGG - Intronic
1153678499 18:7477458-7477480 TTTCTCCTTCAGAATGCCGCGGG - Intergenic
1153739616 18:8110198-8110220 CTTCTTCTTCAGAAGCTTGTAGG + Intronic
1154944302 18:21146793-21146815 ATTCTCCCTCAGATTTTTGAGGG + Intergenic
1155568617 18:27164822-27164844 GTTTTCCTTGAGAATTTTGAAGG - Intronic
1156248124 18:35322921-35322943 CTTCTCCTTAAGAATAAGGAGGG + Intergenic
1156578192 18:38344164-38344186 TTTCTCCTTCAGTATGATGTTGG - Intergenic
1156987103 18:43361409-43361431 CTTCTCCTTAAGAATAAGGAGGG + Intergenic
1157896521 18:51473933-51473955 ATTTTCCTTCATAATTTTGAAGG + Intergenic
1158175697 18:54653622-54653644 AAACTCCTTGAGAATGTTGAAGG - Intergenic
1159868824 18:73737554-73737576 CTTCTCCTTCAGTAGGTGAATGG - Intergenic
1160561323 18:79758356-79758378 CTTCTCCTTCAGTATTTTGTTGG + Intergenic
1160853851 19:1207140-1207162 CTTCTTCTTGAGGATCTTGACGG - Exonic
1162497839 19:11033360-11033382 CTTCTCCTCCACGCTGTTGACGG - Exonic
1162500475 19:11050715-11050737 CCTCTCCTGCAGAATGTTTCAGG - Intronic
1163155306 19:15436963-15436985 CAGCTCCTGCAGGATGTTGATGG + Exonic
1163320382 19:16571524-16571546 CTTCTCCTTCATAATGATCCGGG + Exonic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1167863714 19:52306922-52306944 CTTTTTCTTCAAAATGATGAGGG + Intronic
927261617 2:21097323-21097345 CTTCTCCTTGAGAAGGTAAAAGG + Intergenic
927996827 2:27492717-27492739 CTTCTCCTTGGGATTGTTGTTGG + Exonic
928372476 2:30750741-30750763 CTTCTAAATCAGAATGTTTAAGG - Intronic
929932838 2:46272139-46272161 CCTCTAGTTGAGAATGTTGAAGG + Intergenic
929976112 2:46636630-46636652 ACTTGCCTTCAGAATGTTGAAGG + Intergenic
930036789 2:47090718-47090740 CTTCTCCCTCTGACTGTTAAAGG + Intronic
930170133 2:48243337-48243359 TTTTGCCTTTAGAATGTTGAAGG - Intergenic
931015696 2:57977823-57977845 CTGCTCGTTCAGTATGTTGCTGG + Intronic
931752428 2:65341639-65341661 TTCCTCCTTCAAAATGTTGCAGG + Intronic
931988775 2:67768459-67768481 AATTTCCTTCAGAATTTTGAAGG - Intergenic
932001311 2:67887508-67887530 CATCTCCTTCCTAATGTTTATGG - Intergenic
932375847 2:71235239-71235261 ATTATCCTTCTGAATTTTGAAGG - Intergenic
933304821 2:80584401-80584423 CCTCTCCCTCAGAATGTTGTAGG - Intronic
933354882 2:81197861-81197883 CTTCACTTTTAGGATGTTGATGG + Intergenic
933493007 2:83012328-83012350 CTTCTCCTTCAATATTGTGATGG - Intergenic
933799731 2:85951104-85951126 CTCCTCCTTTAGATTTTTGACGG - Intergenic
935663810 2:105492604-105492626 ATTTTCCTTCAGGATTTTGAAGG + Intergenic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
936503912 2:113089374-113089396 CTTCTCCTTGAGAAAGATGCAGG + Intergenic
937551991 2:123106095-123106117 GTTCTCCTTTAAAGTGTTGAAGG - Intergenic
937832931 2:126443660-126443682 CTTCCCCTTCAGTATTTTTAGGG + Intergenic
937845189 2:126571787-126571809 CTGTTACTTCAGAATATTGATGG + Intergenic
937862294 2:126720635-126720657 CTTTTCCTTCAGTATGCTCAAGG + Intergenic
938205179 2:129415359-129415381 CTTTTCTTTAAGAATGTTGAGGG + Intergenic
939236791 2:139504422-139504444 CTTGTCCTTCAAAATCTAGATGG - Intergenic
939256434 2:139749941-139749963 ATTTTCCTTCAGAAATTTGAAGG + Intergenic
939677509 2:145090677-145090699 GTTGTTGTTCAGAATGTTGATGG + Intergenic
940163836 2:150745357-150745379 CTTCTCCTTCAGCATTGTGTTGG - Intergenic
940494172 2:154404152-154404174 CTTGTCCTTCAGAATGCAGCAGG - Intronic
940978563 2:159974793-159974815 CTTCTTCATCAGAATGTAGCAGG + Intronic
941465793 2:165825285-165825307 ATTTTCCCTCAGAATGTTGAAGG + Intergenic
942485308 2:176433189-176433211 CTTTTCCTTCAGAATTTTAAAGG + Intergenic
942753200 2:179311295-179311317 CATTTCCTTCAGATTATTGATGG - Intergenic
943037819 2:182768006-182768028 ATTCTCCTTCAAAATGTGGGGGG - Intronic
944358393 2:198821246-198821268 AATTTCCTTCAGAATGTTGAAGG + Intergenic
944939938 2:204613249-204613271 ATTCTCTTTCAGAATTTTGAAGG + Intronic
945502062 2:210588606-210588628 GTTCTCCTTGAGAATTTTTAAGG - Intronic
945781827 2:214184515-214184537 GTTCTCCCTGAGAATGTTGTGGG - Intronic
946276182 2:218633550-218633572 CTTCTCTCTCAGACTGCTGAGGG + Intronic
947148708 2:227092190-227092212 TTTCTCCCTCAGGATTTTGATGG - Intronic
947238892 2:227973010-227973032 CTCATCCTTCAGAATGTCAAGGG - Intergenic
948007745 2:234624300-234624322 CTGCTCCTTCAGAATTTGCAGGG - Intergenic
948616399 2:239202079-239202101 CTTCTCCATCAGAATGTTCTCGG - Intronic
1169234249 20:3916727-3916749 CTGCTCATTTAGAATGTTGGAGG + Intronic
1169313118 20:4564626-4564648 CTTGACTTTAAGAATGTTGATGG + Intergenic
1170161502 20:13317480-13317502 CTTCTCCTTCAATATTTTGTTGG - Intergenic
1170800146 20:19583924-19583946 CTTCTCCTGCAGACTATTGTGGG + Intronic
1171388205 20:24784427-24784449 CTTCTCTTTAAGGCTGTTGATGG + Intergenic
1171900639 20:30853150-30853172 TTTCTCCTTGAGAGTATTGAAGG - Intergenic
1172398914 20:34632240-34632262 CTTTTCCTTTAGAATTTTGAAGG - Intronic
1172740334 20:37161510-37161532 GTTCTCCTTGAGTATGTGGAAGG + Intronic
1173895639 20:46548750-46548772 CTTATCCTTCAAGCTGTTGATGG - Intronic
1177061380 21:16378424-16378446 TCTCTCCTTCAGAATTTTTAAGG - Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1180321042 22:11321612-11321634 TTTCTCCTTGAGAGTATTGAAGG + Intergenic
1180334001 22:11559133-11559155 TTTCTCCTTGAGAGTATTGAAGG - Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1183332975 22:37231283-37231305 CTTCTCCTTCAGTTTCTCGATGG + Exonic
1183511918 22:38240849-38240871 CTTCTCCCTTTGAATTTTGAAGG - Intronic
1183601924 22:38844665-38844687 CTGCTCCTTCAGAAGGTTGGAGG - Intergenic
1183840067 22:40492105-40492127 CTTCTCCTCCAGCATGCTGGAGG + Intronic
1184326413 22:43790859-43790881 CTCCTCCTTCAGAATGTGGCTGG - Intronic
949431007 3:3976028-3976050 CTTCTTCTAAAGACTGTTGAAGG + Intronic
949674818 3:6441290-6441312 CTTCTCATTGAGGATGTTGGGGG + Intergenic
950340522 3:12240093-12240115 CTTCTGCTTAAGAATATTGTTGG - Intergenic
950985599 3:17361820-17361842 CTTCTCTTTCAAGTTGTTGAAGG - Intronic
951086021 3:18513934-18513956 CATCTACAGCAGAATGTTGATGG - Intergenic
951118813 3:18898775-18898797 ATTGCCCTTCATAATGTTGATGG + Intergenic
951645157 3:24881676-24881698 ATTTTCCTTCAGAATTTTGAAGG - Intergenic
952329149 3:32347787-32347809 CTTCTCCATCACAATGTGGGAGG - Intronic
952839980 3:37638065-37638087 CTTCACCTCCATAATTTTGATGG - Intronic
953163125 3:40440675-40440697 ATTTTCCCTCAGAATTTTGAAGG - Intergenic
953306516 3:41835626-41835648 CTTTTCCTTTAGAATGTAGGTGG - Intronic
953433597 3:42859679-42859701 CTTCTCTTTAAGAATGTTGAAGG - Intronic
954698755 3:52441038-52441060 CTTATCCTGCAGAATGATGCTGG - Exonic
955569434 3:60288443-60288465 CTTCTACCTCACAATGTTGGTGG + Intronic
955820717 3:62892892-62892914 CTTCTACTTCTGAATCTTAAGGG + Intergenic
956279605 3:67542172-67542194 CTTTTCTTTAAGAATGTTGAGGG - Intronic
956345474 3:68273183-68273205 CTTCCCCTTCACATGGTTGAAGG - Intronic
957691682 3:83579150-83579172 CAACTCCTACAGAATTTTGATGG + Intergenic
958864263 3:99482818-99482840 ATTCTCTTTAAGAATATTGATGG + Intergenic
958961848 3:100518075-100518097 CTTCCCCTTCATACTGTTCAGGG - Intronic
960718393 3:120600893-120600915 CAAATCCTTCAGAATGTAGAAGG - Intronic
961015583 3:123465758-123465780 CTTCTCCTTTGGATTGTAGATGG - Intergenic
961159400 3:124710027-124710049 CTTTTCATTCACAATTTTGAAGG - Intronic
962341705 3:134591176-134591198 ATTATTCTGCAGAATGTTGAAGG + Intergenic
962617273 3:137139198-137139220 ATTTTCCTTCAGAATTTTAAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962932395 3:140050468-140050490 CTTCTCCTTCAGCCTGGGGATGG - Intronic
962993283 3:140599587-140599609 ATTTTTCTTCATAATGTTGAGGG + Intergenic
964831453 3:160887875-160887897 CTTTTCTTTAAGAATGTTGGAGG - Intronic
965071163 3:163916933-163916955 CATCTGCTTCAGAATGATGGGGG - Intergenic
966235755 3:177700279-177700301 CTTCTACCTCAGCATGTTCAAGG - Intergenic
966489429 3:180510726-180510748 TTTCTCCTTCAGAATTTTGAAGG - Intergenic
968681446 4:1923394-1923416 CTTCTCCTTCAGAATTGTTTCGG - Intronic
971115011 4:23635459-23635481 CTTCTCTTTCACTCTGTTGATGG - Intergenic
972103506 4:35452078-35452100 CTTCTCCTTCAAAATAGTGTTGG - Intergenic
973642845 4:52920330-52920352 CTGCTCATTCAAAATGTTTACGG + Intronic
973877505 4:55234915-55234937 CTTTTCTTTACGAATGTTGAGGG + Intergenic
975171318 4:71234754-71234776 CTTTTCCACCAGAATCTTGATGG + Intronic
975793487 4:77982901-77982923 TTTCTTCTTTAGGATGTTGAGGG - Intergenic
977890209 4:102301198-102301220 GTTTTCATTCAGAATATTGAAGG + Intronic
978097490 4:104795942-104795964 CATCTGCTTCAGAATACTGATGG - Intergenic
978912951 4:114086669-114086691 CTGCAACTTCAGAATGTTTATGG + Intergenic
979040301 4:115782773-115782795 CTTCACCTTAAGAATGCTGTAGG + Intergenic
979465763 4:121036763-121036785 CTTCTGTCTCAGAATGTGGAAGG - Exonic
979690263 4:123551949-123551971 CTTTTCCTTCAGATTTTTGAAGG + Intergenic
980831826 4:138138707-138138729 CTGTTTCTTCAGATTGTTGAGGG + Intergenic
981328539 4:143481208-143481230 CTTCTCCTTTCTACTGTTGATGG - Intergenic
981486239 4:145289441-145289463 CTTCTTCTTAAGAAAGATGAAGG - Intergenic
981678244 4:147364312-147364334 ATTTCCCTTCAGAATTTTGAAGG - Intergenic
982489007 4:156005137-156005159 CTCCTCCTTCACAATTTGGATGG - Intergenic
983612070 4:169657713-169657735 CTTCTCCTTTTGAATTTTGATGG + Intronic
984151455 4:176137977-176137999 CTTCACCTAAAAAATGTTGAAGG + Intronic
984191386 4:176610101-176610123 ATTTTCCCTCAGAATTTTGAAGG + Intergenic
985441881 4:189987682-189987704 TTTCTCCTTGAGAGTATTGAAGG + Intergenic
987818283 5:22931481-22931503 TTTCTCCTTCACATTTTTGATGG - Intergenic
988063869 5:26209337-26209359 TTTCTCCTTCAGTATGATGTTGG - Intergenic
988125930 5:27037071-27037093 CTTCTTCTGCAGAATGTAGGAGG + Intronic
989381788 5:40816559-40816581 CATTTCCTTCAGAATTTTGAAGG + Intergenic
989967225 5:50478677-50478699 ATTTTCTTTCAGAATGTTGGAGG - Intergenic
991242002 5:64470923-64470945 CTTTTCTTTAAGAATGTTGAGGG - Intergenic
992076361 5:73196263-73196285 CTACTCTTTCAGAAGCTTGAAGG - Intergenic
992636682 5:78731336-78731358 CTTCTACTTCACAATTTTGCTGG + Intronic
993050044 5:82915964-82915986 ATTTTCCTTCAAAATCTTGAAGG + Intergenic
993245474 5:85446102-85446124 CTTCTCAATTAAAATGTTGATGG + Intergenic
993540138 5:89139079-89139101 CTTATCTTCCAGAATGTTTATGG + Intergenic
994072309 5:95616882-95616904 CTTTTCCTTCTGAATTTTGAAGG - Intergenic
995656274 5:114430078-114430100 CTTCTCCTTCAAAATTATGTTGG + Intronic
996447876 5:123578091-123578113 CTTATCCATTTGAATGTTGATGG + Intronic
996892771 5:128441915-128441937 TTTCCCCTTGAGAATGTTAATGG + Intronic
997592188 5:135081453-135081475 ATTTTCCTTAAGAATTTTGAAGG + Intronic
998227240 5:140336458-140336480 TTTCTGGGTCAGAATGTTGAGGG - Intronic
998773232 5:145569947-145569969 CCTCCCCTTCAGAATTGTGAGGG - Intronic
998854471 5:146381040-146381062 ATTTTCCTTCAGAGTCTTGAAGG - Intergenic
998976683 5:147656977-147656999 ATTTTCTTTAAGAATGTTGATGG + Intronic
1000191938 5:158919510-158919532 CTTCTCATTCTCAAAGTTGAAGG - Intronic
1000668922 5:164035452-164035474 TTTTTCTTTCAGAATTTTGAAGG + Intergenic
1000820905 5:165982175-165982197 ATTTTTCTTCAGAATGTTGAAGG + Intergenic
1002433172 5:179215880-179215902 ATTTTCCTTCAGAATTCTGAAGG - Intronic
1002456914 5:179350516-179350538 CTTCTCCTCCAGAAGGGAGAAGG + Intergenic
1002942613 6:1731550-1731572 ATTTTCCTTCAGAACTTTGAAGG - Intronic
1005321265 6:24656705-24656727 GTTTTCCTTCAGAATTCTGAAGG - Intronic
1007531989 6:42551248-42551270 ATTTTCCTCCAGAATTTTGAAGG - Intergenic
1007848803 6:44783454-44783476 CTTCTCATCCAGACTGTTCAAGG - Intergenic
1009501050 6:64414298-64414320 CATTTCCCTCAGAATTTTGAAGG - Intronic
1009798808 6:68506183-68506205 CTTCTCCTTCAGTATCGTGTTGG + Intergenic
1009934691 6:70219943-70219965 CTTCTCCTGAAGTGTGTTGATGG - Intronic
1011661730 6:89600683-89600705 TTTCTCTATCAGAATGGTGACGG - Intronic
1013727695 6:113119946-113119968 CTTCTCCTCCAAAATGTGTAGGG - Intergenic
1014354246 6:120384684-120384706 CTTAGCCTTCATAAAGTTGAAGG + Intergenic
1014550133 6:122780475-122780497 CTTCTTCTTCAGAGTGGGGATGG + Intronic
1015939660 6:138434948-138434970 CTTCTCCTTCACTGTGATGATGG + Intronic
1016384607 6:143518151-143518173 TTTCTCCTTCAGATTTTAGATGG + Intergenic
1016956573 6:149632790-149632812 CTTCTCCCTCAGAAGCTGGAAGG + Exonic
1017022473 6:150151665-150151687 CATCTCCTTCATAAAGTTGTTGG - Intronic
1018223771 6:161607959-161607981 ATTTTCTTTCAGAATGTTGAAGG - Intronic
1018493443 6:164321702-164321724 CTTCCCATTCAGAAGGTTCACGG - Intergenic
1018672272 6:166189583-166189605 CTTCACCTTCAGAATTTATAAGG + Intergenic
1018685871 6:166304246-166304268 CTTCTCCCACACAATGCTGAGGG + Intergenic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1019375048 7:685715-685737 AGTTTCCTTCAGAATGTTGGAGG - Intronic
1019494606 7:1331976-1331998 CTCCTCCTTCAGAATGTCCTGGG - Intergenic
1020507675 7:9014145-9014167 CACCTCATTCAGAATGCTGATGG - Intergenic
1020942113 7:14553252-14553274 CTTTTCCTTCAAAATACTGAGGG + Intronic
1020969518 7:14917977-14917999 TTTCTCCTTTAGCTTGTTGATGG - Intronic
1021010329 7:15455697-15455719 ATTTTCCTTCAGAATTTTGAAGG + Intronic
1021462718 7:20907209-20907231 CTTCTCTTTGAGAAGGGTGAGGG + Intergenic
1021738949 7:23666077-23666099 CTTCTCCTTCAAAATATTCAGGG + Intergenic
1021995195 7:26172611-26172633 CTTCACCTTTAGATTGTTGAAGG + Intronic
1022244710 7:28547538-28547560 ATTATCCTTCATAATGTTGGTGG - Intronic
1022457186 7:30567771-30567793 CTTCTCCTTGTAAATGTTAAAGG + Intergenic
1023212393 7:37821391-37821413 GTTCTCCTGCAGAATGGTGAGGG - Intronic
1024785379 7:52901492-52901514 CTTCTTCTTGACAATTTTGAGGG + Intergenic
1024954906 7:54907351-54907373 CCTTTCCTTCAGAATATTAAAGG + Intergenic
1025261905 7:57425512-57425534 CTGCTCCTTCAGCATGAGGATGG - Intergenic
1025798184 7:64759238-64759260 CTTTTCCTTCATAATGAGGATGG + Intergenic
1027594658 7:80158179-80158201 CTTCTCCTTCAGTATCATGTTGG + Intronic
1027821539 7:83051742-83051764 CTTCTTCTTCAGTATTCTGATGG - Intronic
1028156235 7:87432893-87432915 CTTCTTTTTCAGAATTTTCATGG - Intronic
1028445201 7:90914133-90914155 GTTTTCCTTCAGGATGTTAAGGG + Intronic
1029179302 7:98688431-98688453 CTTGTGCTTGTGAATGTTGAGGG - Intergenic
1029452781 7:100651135-100651157 ATTATTCTTCAGAATCTTGAAGG - Intronic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1031529727 7:122861905-122861927 ATTCTCCCTCAGAACTTTGAAGG - Intronic
1032507590 7:132447332-132447354 CTTCCCATTGAGAATCTTGAAGG - Intronic
1032897883 7:136272252-136272274 CCTGTCCTTCAGAATCTTTAAGG - Intergenic
1033108551 7:138554555-138554577 GTTCTCTTTCAGAGTGTTAAAGG + Intronic
1033221855 7:139532172-139532194 ATTCTCCTTCAGAATTTTGAAGG - Intronic
1034281765 7:149859538-149859560 CATGTCCTTCAGAATGCTGTAGG - Intronic
1034744444 7:153510514-153510536 TTTCTCCTTCACGCTGTTGAAGG + Intergenic
1035138884 7:156737243-156737265 ATTCTCCTTCAGAATTCTGAAGG + Intronic
1036673316 8:10807680-10807702 ATTTTCCTTCAGCATTTTGAAGG - Intronic
1036694578 8:10966198-10966220 TTTCTCATTCAGTATGTCGAGGG + Intronic
1037718641 8:21421983-21422005 CTGCTTCTTCAGCATGTTTATGG + Intergenic
1037852269 8:22341220-22341242 CTTCTTCTTTAGCCTGTTGATGG - Intronic
1038046574 8:23770422-23770444 ATTTTCCCTCAGAATGTTGAAGG - Intergenic
1038273022 8:26091900-26091922 TTTCTCCTTCAGTATTTTGTTGG - Intergenic
1038404408 8:27310993-27311015 CTTCTCCACCAGGTTGTTGAGGG + Exonic
1039115906 8:34090993-34091015 CTTCTCCTTGGGAATGGTTATGG + Intergenic
1039323650 8:36461290-36461312 CTTCTTCGTAAGACTGTTGATGG + Intergenic
1040746329 8:50646756-50646778 CTTCTACTTCAGTATGGTGTTGG - Intronic
1042673817 8:71294777-71294799 CTTCTCCTTCAGCATTGTGTTGG - Intronic
1043938106 8:86166288-86166310 CCTCTCCTTCAAAGTGTTGAAGG + Intergenic
1044005056 8:86929131-86929153 TTTCTCCTTCACCATTTTGATGG + Intronic
1044717913 8:95117768-95117790 CTTCTCCTTCAGAGTGATAGTGG + Intergenic
1045972393 8:108093611-108093633 ATTCTCCTTTAGTATTTTGAAGG + Intergenic
1046130823 8:109966278-109966300 CTTTCCCTTCAGATTGTGGAAGG + Exonic
1046352685 8:113036181-113036203 TTTCTCATTCACAATTTTGAGGG + Intronic
1046423770 8:114018976-114018998 CTTCAACTTAAAAATGTTGAAGG - Intergenic
1047261877 8:123270160-123270182 CTTCTTTTTAAGAATATTGATGG + Intronic
1047832611 8:128652678-128652700 CTTACCCTTCAGCATGTTTATGG - Intergenic
1047866522 8:129029945-129029967 ATTTTCCTTCAAAGTGTTGAAGG + Intergenic
1049005664 8:139854099-139854121 TTTCTCCTGTAGAATGTTGAAGG - Intronic
1049239976 8:141532562-141532584 CTTCGCCCCCAGAATGTTCATGG + Intergenic
1049987454 9:965060-965082 CTTCTCCTTCCAAAAGTTTAAGG + Intronic
1050376053 9:4974454-4974476 CTTCTCCTTAAGAACTTTCAAGG - Intergenic
1052372248 9:27678353-27678375 CTTCTCCTTACAAATTTTGAAGG + Intergenic
1052610347 9:30764801-30764823 CTTATTCTTCAAAATGTGGAGGG - Intergenic
1053109651 9:35447216-35447238 CTTCTCCTGCAGAAAAATGAAGG - Intergenic
1054722683 9:68618891-68618913 CTTTTCCTTCAGAAGTTTGAAGG + Intergenic
1054732296 9:68713586-68713608 CTGCTCCTTCAGAAATATGAGGG + Intronic
1054942248 9:70755665-70755687 CTTTTCTTTAAGAATGTCGATGG - Intronic
1054946604 9:70803073-70803095 CTTCCCCTTCAGAAAATTGGTGG - Intronic
1055611114 9:78025645-78025667 TTTCTCCCTCAGAAGGTGGAGGG - Intronic
1055859736 9:80733754-80733776 CATTTGCTTCAGAATTTTGATGG - Intergenic
1055999452 9:82198815-82198837 TTTGTCCTTCAGAATATTTAAGG - Intergenic
1057749031 9:97775680-97775702 ATTTTCCTTCAGAATTTTGGAGG - Intergenic
1058240734 9:102554849-102554871 TTTCTCCTTCAGTATGATGTTGG - Intergenic
1059858576 9:118430365-118430387 CTCCTCCTTCTGCCTGTTGATGG + Intergenic
1061512470 9:131069495-131069517 ATTCTGATTCAGAAGGTTGAAGG - Intronic
1061740177 9:132697514-132697536 ATTTTCTTTCAGCATGTTGAAGG - Intergenic
1062546232 9:137064881-137064903 CTGCTCCTTCAGCATGAGGATGG + Exonic
1186438404 X:9564070-9564092 ATTTTCCCTCAGAATTTTGAAGG + Intronic
1186765571 X:12767471-12767493 GTTTTCCTTCACAATGTTAAAGG - Intergenic
1187849301 X:23575593-23575615 TTTCTCCTTCATATTTTTGAAGG - Intergenic
1188608456 X:32064818-32064840 CTTCTCCTTCAGGATAATGGGGG + Intronic
1191606127 X:63065065-63065087 CTTCTTCTTCAGAAAATTTATGG - Intergenic
1192159758 X:68775668-68775690 CTTCCCTTTCAGAGGGTTGAGGG - Intergenic
1193805941 X:85994522-85994544 CCTCTACTTCAGAATATTCATGG + Intronic
1196384857 X:115138245-115138267 CTTCTCCTTCGGTATGCTGCAGG - Intronic
1196666158 X:118318949-118318971 ATTTTCCTTCAGAATTTTGAAGG - Intergenic
1197095835 X:122594064-122594086 CTTCTCCTTCAGGTTTTAGAGGG - Intergenic
1197830076 X:130632335-130632357 CTTCTCTTTCAGAATGTAGCAGG + Intronic
1198212247 X:134527248-134527270 ATTTTCCTTCAGAATATTGAAGG + Intergenic
1198717910 X:139581473-139581495 CTTCTCCATGGGAATGCTGAGGG - Intergenic
1198959147 X:142165681-142165703 CTTATACTTCATAATGTTGGTGG - Intergenic
1199013829 X:142789462-142789484 ATACTCCTTCAGGATGCTGATGG - Intergenic
1199249179 X:145639558-145639580 CTTCTTGTGCAGAATCTTGATGG - Intergenic
1201069027 Y:10127574-10127596 TTTCTCCTTGAGAGTATTGAAGG - Intergenic