ID: 908414178

View in Genome Browser
Species Human (GRCh38)
Location 1:63896690-63896712
Sequence GCTTATAAGCAGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908414173_908414178 -1 Left 908414173 1:63896668-63896690 CCTTAGAAGACAGCCTGAAATTG No data
Right 908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908414178 Original CRISPR GCTTATAAGCAGAGGGGAGC AGG Intronic
No off target data available for this crispr