ID: 908414978

View in Genome Browser
Species Human (GRCh38)
Location 1:63904390-63904412
Sequence CTTTTCCTCAGGATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908414970_908414978 30 Left 908414970 1:63904337-63904359 CCAGATGTTGGCAGAGTTGGAAG No data
Right 908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 220
908414973_908414978 0 Left 908414973 1:63904367-63904389 CCCTTGACTCACAGTCCCAGGCT No data
Right 908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 220
908414971_908414978 5 Left 908414971 1:63904362-63904384 CCATGCCCTTGACTCACAGTCCC 0: 1
1: 0
2: 0
3: 33
4: 283
Right 908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 220
908414974_908414978 -1 Left 908414974 1:63904368-63904390 CCTTGACTCACAGTCCCAGGCTC 0: 1
1: 0
2: 3
3: 31
4: 315
Right 908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG 0: 1
1: 0
2: 2
3: 31
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908414978 Original CRISPR CTTTTCCTCAGGATTTCCCC AGG Intronic
900733502 1:4279360-4279382 CCTTTGCTCAGGATTTCCCAAGG + Intergenic
901795046 1:11675163-11675185 CTCCTCCCTAGGATTTCCCCTGG - Exonic
902156987 1:14495692-14495714 CATTTCCTCCTGATTTCCCGAGG - Intergenic
902207539 1:14880325-14880347 CTTTTCCTCGGGCAATCCCCTGG - Intronic
904273076 1:29363102-29363124 CTTTTCCACAGGATCCCCACAGG - Intergenic
904821490 1:33247675-33247697 CTTTTCCTCTGGCAGTCCCCGGG + Intergenic
906326374 1:44848670-44848692 CTGTTCCTCAGCACATCCCCAGG + Intergenic
908414978 1:63904390-63904412 CTTTTCCTCAGGATTTCCCCAGG + Intronic
912112491 1:106360089-106360111 CCTTTGCTCAGGATGTCACCAGG - Intergenic
913075308 1:115336943-115336965 CTTTTCTACAGGATTTCCATTGG + Intronic
915021051 1:152778636-152778658 CTTCTCCTCAGAAATCCCCCAGG - Intronic
917314902 1:173714485-173714507 CTTATCCTCCAGATTTCCCACGG - Intergenic
917877838 1:179302731-179302753 ATCTTCCTCAGGATTTTCCCTGG - Exonic
919409934 1:197229823-197229845 CTTTTCCTCACGATTTAAGCAGG + Intergenic
920201446 1:204262153-204262175 CTTCTACTCAGCATTCCCCCGGG + Intronic
923711602 1:236392069-236392091 CTTCTCATTTGGATTTCCCCAGG + Intronic
1063818243 10:9802411-9802433 CTTTTCCTCAGTATTACGTCTGG + Intergenic
1064675078 10:17752284-17752306 CTTTTCCTCAGGATGGCTTCTGG + Exonic
1066347983 10:34608028-34608050 CTCTTCCTCAGGATTACTCAGGG - Intronic
1066604457 10:37146726-37146748 TTTTTACTCAGGACTACCCCAGG - Intronic
1068183057 10:53546812-53546834 CATGTCCTCAGGATTTCCTGAGG + Intergenic
1068727509 10:60319940-60319962 CTTTTCTCCAGGAATTCCTCTGG - Intronic
1070079055 10:73168007-73168029 CTTTCTCTCAGGATTTCCGCTGG - Exonic
1071194519 10:83142345-83142367 CTCTCCCTCAGTATTTGCCCAGG + Intergenic
1073803013 10:107064392-107064414 CTTTTCCTCACCATTTCCCCCGG - Intronic
1077676124 11:4194145-4194167 CTTGTCCTCAGGACTGACCCAGG - Intergenic
1077977850 11:7266808-7266830 CTTTTCTCCAGGAGTTTCCCTGG - Intronic
1078084513 11:8225665-8225687 CTTTCCCTAAAGATGTCCCCAGG + Intronic
1078516769 11:12029142-12029164 TTTTTCTTCTGGCTTTCCCCTGG - Intergenic
1079973026 11:27059449-27059471 ATTTTCCTCTGCATTTCCCTAGG - Intronic
1080578688 11:33623558-33623580 CTTTGCCTCAGGTTCTCCCAGGG - Intronic
1080823048 11:35825157-35825179 CTTTCCCTCATGAAGTCCCCAGG - Intergenic
1081851041 11:46275471-46275493 CCTTTCCCCAGGATTTCTCTTGG + Intergenic
1083324510 11:61866522-61866544 CTTTTCCTCAGGGTGTCCTGAGG + Exonic
1084532174 11:69734045-69734067 CTTTTCCTGTGGCTTTCCCAGGG + Intergenic
1084670323 11:70603093-70603115 CGCTTCCTCAGGATTTTCCTTGG - Intronic
1086176153 11:83893491-83893513 CTTTACCCCAGGTTTTCTCCTGG + Intronic
1086250603 11:84808634-84808656 CTTGTCCTCTGGATGTCTCCAGG - Intronic
1086755525 11:90557663-90557685 CTTTTCCCCAGGATAGCTCCAGG - Intergenic
1087811393 11:102612647-102612669 AAGCTCCTCAGGATTTCCCCAGG + Intronic
1089340171 11:117751901-117751923 CTTTTCATCAGGGCTTCCCTAGG + Intronic
1089530386 11:119124409-119124431 CTTCTCCTCAGGAATTCTCACGG - Intronic
1090441093 11:126726291-126726313 TTTTTCCTCAGAAATTTCCCTGG + Intronic
1090511654 11:127381957-127381979 CTTTTGGTCAAGATTTACCCTGG + Intergenic
1090794976 11:130127329-130127351 CTTTTCTTCTGGATTTACTCAGG + Intronic
1091138510 11:133215585-133215607 CTTTACCTCACTGTTTCCCCAGG - Intronic
1091142234 11:133245044-133245066 ATCTTCCTCATGATTTCCCTGGG + Intronic
1091202995 11:133796695-133796717 CCTTTCTTCAGGGTCTCCCCAGG - Intergenic
1095655240 12:44661091-44661113 CTTTTCCACTGGAATGCCCCTGG - Intronic
1096353890 12:50923915-50923937 CATGTTCTCAGGATTTCCCGAGG - Exonic
1098612724 12:72480996-72481018 CTATTATTCAGCATTTCCCCAGG + Intronic
1098688081 12:73451094-73451116 CATTTGCTCAGGATTTCCCTTGG - Intergenic
1099681685 12:85837097-85837119 CTTTTCCTCTGAAATTCCCAGGG - Intergenic
1102425945 12:112844528-112844550 CTTCTGCTCAGGATTTCACAAGG - Intronic
1103125555 12:118419195-118419217 CCTTTCTTCAGGATTTCCCTGGG + Intergenic
1103222594 12:119258209-119258231 CTTCAGCTCAGAATTTCCCCCGG + Intergenic
1104688343 12:130805414-130805436 CTTTGCCTTAGGACTTCCCCTGG - Intronic
1107904366 13:45048571-45048593 CTTTTATTCAGGATTTGCCTGGG - Intergenic
1109922751 13:69090608-69090630 CTTTTCCTTAGGGTTTTGCCTGG + Intergenic
1112884000 13:104146647-104146669 TTTTTACTCAGAATTACCCCAGG + Intergenic
1112964408 13:105169450-105169472 CCTTTCCTAGGGATTTCCTCTGG - Intergenic
1113328418 13:109306124-109306146 TTTATCCTCATGAATTCCCCTGG - Intergenic
1115320722 14:32077037-32077059 CTTTACCTCAGCATCTCTCCCGG - Intronic
1116010913 14:39351293-39351315 CTTCACCCCAGCATTTCCCCAGG + Intronic
1116904795 14:50394206-50394228 CACTTCCTCAGGCTTTCCCAGGG - Intronic
1118335901 14:64853356-64853378 CTCTTCCTCAGGATATGCCCAGG + Intronic
1118792537 14:69108233-69108255 CTTTTACTCACCATGTCCCCCGG - Intronic
1119087793 14:71753310-71753332 CTTGCCTTCAGGATTTCTCCTGG - Intergenic
1123452847 15:20383244-20383266 CTGTTGCTCAGGTTTTCCCTAGG - Intergenic
1124079130 15:26475061-26475083 CATTTCCTTAGGCTTTCCCATGG + Intergenic
1127664431 15:61131494-61131516 ATTTCCCTCAGTCTTTCCCCAGG - Intronic
1129893662 15:79088779-79088801 CTCTTCCACATGAGTTCCCCAGG + Intronic
1131106404 15:89737658-89737680 CCTTTCCTCTGGAGGTCCCCTGG + Exonic
1131898492 15:97061219-97061241 TTTCTACTCAGGAATTCCCCAGG - Intergenic
1133613513 16:7454816-7454838 CTTGTCCTGAGGACTTCCCCAGG - Intronic
1134107090 16:11492958-11492980 CTTTTCCTCCAGATGTCCCCAGG - Intronic
1135972034 16:27079228-27079250 CTTTTCCAAAGGGTTTCCCTAGG - Intergenic
1136274931 16:29173829-29173851 ATTTTCCTCATCATGTCCCCAGG - Intergenic
1136344738 16:29667390-29667412 CTTTTTTTCAGGATTCGCCCAGG - Exonic
1139174432 16:64670323-64670345 CATTTCCTCAAGATTTGACCAGG - Intergenic
1139968598 16:70759737-70759759 CATTTCCTCATGATTTCACCAGG - Intronic
1140791639 16:78397739-78397761 CTTTTTCTCAGGATCACCTCAGG + Intronic
1141055843 16:80812880-80812902 CTTTTCCACAGGATGTCCCAGGG - Intergenic
1141317975 16:82979550-82979572 CTTTTGCTCAGCACTTCTCCTGG + Intronic
1141883254 16:86873820-86873842 CTTTTCCTCAGCAATTCACCTGG - Intergenic
1142079245 16:88139710-88139732 ATTTTCCTCATCATGTCCCCAGG - Intergenic
1144226001 17:13147530-13147552 CTTTTGCTCAGAATTTCACTTGG + Intergenic
1144886638 17:18467468-18467490 CTTCTCCTCAGGAATTCTCCTGG + Intergenic
1145145574 17:20476840-20476862 CTTCTCCTCAGGAATTCTCCTGG - Intergenic
1145813581 17:27780171-27780193 CTTTTCCTCAGAATTTTTCTAGG - Intronic
1146240493 17:31218312-31218334 GTTTTCATTAGGATTTTCCCTGG + Intronic
1147891097 17:43717425-43717447 AGTTAGCTCAGGATTTCCCCTGG - Intergenic
1147972119 17:44224007-44224029 CTTGGCCTCAGTATTTCCCCAGG + Intergenic
1148455850 17:47811039-47811061 CTCTTCCTCAGAAGCTCCCCTGG + Intronic
1152309335 17:79540007-79540029 CTTTTCCTCCTGCTGTCCCCAGG - Intergenic
1153528341 18:6018423-6018445 CTTTACTTCAGAATTTCCCATGG - Intronic
1154499211 18:14986655-14986677 ATTTTGATCAGCATTTCCCCAGG - Intergenic
1156895656 18:42242611-42242633 TTTTTCCTCAGTATTTCACTTGG - Intergenic
1158712939 18:59853268-59853290 CTAGTTCTCAGGATATCCCCGGG + Intergenic
1159032541 18:63246258-63246280 TTTTTCCTCAGGACTTCTCAGGG + Intronic
1164136387 19:22420585-22420607 CTTTTCCCCAGGGTATCCACTGG + Intronic
1164934967 19:32202968-32202990 CTTTTCATCACCATCTCCCCAGG + Intergenic
1165067825 19:33239345-33239367 CTTTTCCTCTGCAGTTACCCTGG + Intergenic
1168518679 19:57031029-57031051 GTTTTCCTCAGGATATTCCAGGG - Intergenic
1168583061 19:57571299-57571321 CTTGTCCTCAGGATGACCTCTGG + Intergenic
926824927 2:16896510-16896532 CTGTTTCTCACAATTTCCCCGGG + Intergenic
927045744 2:19276329-19276351 CTCTTCCTCAGCCTTTCCCCTGG - Intergenic
929342515 2:40838551-40838573 CTCTTCCTCAAGATTTGCTCTGG - Intergenic
932021816 2:68095189-68095211 CTTTTCCTTAGGTTTTGCCGTGG - Intronic
933184977 2:79268609-79268631 CTGTTCCTCAAGACTGCCCCTGG - Intronic
933253218 2:80051735-80051757 ATTTTCCTCAGGAATTCTTCAGG - Intronic
933598798 2:84308876-84308898 CTTTTCCTCTGGGTTTCTCTGGG - Intergenic
934872773 2:97882543-97882565 CCTCTCCTCAGGATCTTCCCTGG + Intronic
936776229 2:115976715-115976737 CTTTTCCTCAGTACTTCCACTGG - Intergenic
938126813 2:128680232-128680254 CTCTTCCTCTGGCTTTCTCCTGG - Intergenic
938498423 2:131817023-131817045 ATTTTGATCAGCATTTCCCCAGG - Intergenic
938673389 2:133605859-133605881 CTTTTCCTCTTGATTTACCCAGG - Intergenic
938760419 2:134420608-134420630 CTTTTCCTCAGGATACTCACAGG - Intronic
941522625 2:166566200-166566222 CTTTTGCTCAAGATTTCTTCAGG - Intergenic
946174654 2:217915081-217915103 CATTTTTTCAGGATTTCCCAAGG + Intronic
946381429 2:219351610-219351632 CTCTTCCTCCAGATCTCCCCCGG + Intergenic
946492700 2:220165437-220165459 TTATTCCTCAGTATTTTCCCAGG + Intergenic
946748256 2:222866780-222866802 AATTTCCTTATGATTTCCCCGGG - Intronic
947443538 2:230144220-230144242 CTTTTCCTCTCCATTTTCCCAGG + Intergenic
947612399 2:231532056-231532078 CTGTTACTGAGGATTTCTCCTGG - Intergenic
947642055 2:231712370-231712392 ATGTTCCTCGGGATTTCCCCAGG + Intronic
947988036 2:234465450-234465472 TTTTGCCTCAGGATGTCCTCCGG - Intergenic
1169786426 20:9364161-9364183 CTTTTCCTCTGCAGTTGCCCTGG + Intronic
1169962552 20:11177783-11177805 CTTTGCCTGAGGACTTGCCCTGG + Intergenic
1170121410 20:12916605-12916627 CTTGTCCCCAGACTTTCCCCAGG - Intergenic
1172310425 20:33913713-33913735 TTATTCCTCAGGTTTTCCCATGG + Intergenic
1173261436 20:41439756-41439778 CTGTTCCTCATGAGTTTCCCAGG - Intronic
1174259636 20:49284529-49284551 CTTTTTCTTACTATTTCCCCTGG + Intergenic
1175261864 20:57679781-57679803 TTTTTCCCAAGGTTTTCCCCTGG - Intronic
1177307973 21:19346106-19346128 CATGTCCTCAGGATTTCCTGAGG - Intergenic
1177530806 21:22355539-22355561 CTTTTCCTGTGGAATGCCCCTGG - Intergenic
1179258228 21:39736235-39736257 CCTTTCCTCAGGGATTCCCAGGG + Intergenic
1179392090 21:41003290-41003312 ATTTTTCTCAAGATTTCCCTTGG - Intergenic
1179620028 21:42608060-42608082 CGTGTTCTCAGGATTTCCCAAGG - Intergenic
1180910042 22:19443535-19443557 CCTTCCCTCAAAATTTCCCCTGG - Exonic
1181039741 22:20186306-20186328 GTTTAACTCAGTATTTCCCCAGG - Intergenic
1181591843 22:23890083-23890105 CTTGTCCTCAGGCTGTGCCCAGG + Intronic
1182728324 22:32466963-32466985 CTTTTCCTCACTATTTTCCCCGG + Intergenic
949786030 3:7742915-7742937 CTTTTCCTCTGGATTCCCAGGGG + Intergenic
952732349 3:36652030-36652052 CTGTTCCTTAGCATTTCCTCAGG - Intergenic
952979508 3:38723480-38723502 ATCTTCCTCAGGATTTCCTCAGG + Exonic
953200136 3:40771096-40771118 ATTATCCTGAGGATTTCCCATGG - Intergenic
955371490 3:58355835-58355857 CCTGGCCTCAGGACTTCCCCGGG + Intronic
957175897 3:76809184-76809206 CTTCTGCTCAGGATTTCACTAGG + Intronic
960231488 3:115233028-115233050 CCTTGCTTCAGGATTGCCCCTGG - Intergenic
961136158 3:124513252-124513274 CTTTTCCTCACCTTTTCCACAGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962611322 3:137078981-137079003 TTTTTCCTCACAATTACCCCAGG + Intergenic
965757831 3:172042362-172042384 CTTTTGCTCAGTATTTAACCTGG + Intronic
968845142 4:3036812-3036834 CTGTTCCTCAGGTTTTCTCCGGG + Intronic
969380145 4:6790247-6790269 CTCTTCCTCAGTGTTGCCCCTGG + Intronic
969867290 4:10084217-10084239 CTTTTCCTCAGCATAAGCCCTGG + Intronic
969911329 4:10449319-10449341 CTTTTCATCAGGATTACCTAGGG - Intronic
971202773 4:24527336-24527358 CTTTTCCTAAGGAGTACTCCTGG + Intronic
971353080 4:25870055-25870077 TGTTTCCTCAGTATTTCCCCGGG + Intronic
971705044 4:30030661-30030683 CTTTGCCTCAGGATTCCACATGG + Intergenic
973570030 4:52229263-52229285 CATTTCTTCAGTATTTTCCCAGG - Intergenic
974190867 4:58501014-58501036 CTTTTCCACAGAAATTCCCATGG + Intergenic
974439705 4:61900029-61900051 CATGTCCTCAGGAGTTCTCCAGG - Intronic
974879374 4:67735151-67735173 CTTTTGCTCAGGGTTTCACTGGG + Intergenic
976383360 4:84426499-84426521 CTTCTCCTCAGGATTCACTCAGG - Intergenic
976629051 4:87219176-87219198 CTTTTCCTCAGACTTCCTCCTGG - Intronic
977022737 4:91776529-91776551 CATTTCCTCAGATTTACCCCTGG - Intergenic
978264967 4:106812740-106812762 CTTGTCCACAGGATATTCCCAGG + Intergenic
984646132 4:182222115-182222137 TTGTTCTTCAGGATTGCCCCGGG + Intronic
985547840 5:518978-519000 CCTTTCCTCAGGATTCTCCCGGG + Intronic
986967112 5:13287421-13287443 CTCTTCCTCCAGATTTCCCCTGG - Intergenic
987252829 5:16118121-16118143 GTGTTCCTCAGGATTGCCACAGG - Intronic
987831754 5:23104574-23104596 CTATTCCTCAGGTTTTTCCTGGG - Intergenic
988347031 5:30050463-30050485 CTTTTGCTCAGGGTATCCCTGGG + Intergenic
989100204 5:37815968-37815990 CTTTTCCTCTGGAATTCTCTGGG + Exonic
989663125 5:43821351-43821373 CTTTTCCTCTGGCTATCCTCAGG - Intergenic
991215830 5:64156601-64156623 CTTCTCCTTACTATTTCCCCAGG - Intergenic
991532663 5:67632883-67632905 CTTTACCTCATGTGTTCCCCTGG - Intergenic
991928729 5:71730739-71730761 CTTTCCCTGAGGATATACCCAGG - Intergenic
992001941 5:72444320-72444342 CATTTCCACAGCATTTCCTCAGG - Intronic
993100922 5:83538772-83538794 CTTTTCCACAGGTTTTCCTTTGG + Exonic
993414362 5:87608227-87608249 CTGTTCCTCAGTTTTTGCCCAGG + Intergenic
994045370 5:95303204-95303226 CATTTCCTCAGGATATCTCCAGG + Intergenic
994289721 5:98014584-98014606 CCCTTCCCCAGGACTTCCCCAGG + Intergenic
995418692 5:111938053-111938075 CTTTCCCTCAGGGTTTCCTCTGG + Intronic
998106804 5:139473945-139473967 CTTGTCCCCAGGAGTTCCCCAGG - Intergenic
998561737 5:143178700-143178722 CATTTCCTCACGATTGCCCCAGG + Intronic
999281951 5:150372002-150372024 GTTTTACTGAGGGTTTCCCCTGG - Exonic
999952792 5:156668400-156668422 CTTATCCCCAGTATTTCTCCAGG + Intronic
1000197110 5:158970387-158970409 CCTTTTCACATGATTTCCCCAGG - Intronic
1001465942 5:171966325-171966347 TTTTTCCTTTGGATTTCCTCAGG - Intronic
1002163084 5:177328320-177328342 CAGTTCCTCTGGGTTTCCCCAGG - Intergenic
1002459701 5:179367272-179367294 ATTCTCCACAGGATTCCCCCTGG - Intergenic
1003135597 6:3432720-3432742 CTTTTCCTAAGATTTTCCCAGGG - Intronic
1005758044 6:28943333-28943355 TTTTTCCTTAGGATTGCCCTTGG + Intergenic
1006710759 6:36068151-36068173 CTCTTCCTCTAGATATCCCCAGG - Intronic
1007334113 6:41139128-41139150 CTTTTCCTCCAGGTTTGCCCAGG + Intergenic
1010136617 6:72561726-72561748 GTATTTCTCAGGTTTTCCCCAGG + Intergenic
1010393425 6:75362770-75362792 CTTCTCCTATGGATTTCTCCTGG + Exonic
1010895916 6:81363950-81363972 ATTCTTGTCAGGATTTCCCCAGG - Intergenic
1013087227 6:106866895-106866917 CTTTTGCTCAGGGATTCCCAAGG - Intergenic
1013684360 6:112562055-112562077 CTTCTCCCCAGGATTTCTCAGGG + Intergenic
1014539349 6:122655011-122655033 CTTTTGCCCAGGCTTTGCCCAGG + Intronic
1017322558 6:153110856-153110878 CATTTCCTCATGGTTTCCCTTGG - Intronic
1018206160 6:161439127-161439149 CTTTTCCTCCGGGTTACACCTGG - Intronic
1021605619 7:22406539-22406561 CTTTTCCCCTGGATTTCCCCAGG + Intergenic
1022472515 7:30690584-30690606 GTTTGCCCCAGGATGTCCCCAGG + Intronic
1028219913 7:88185028-88185050 CTTTTTCTACGGTTTTCCCCAGG + Intronic
1033589507 7:142797618-142797640 CTCTTCCCCAGTCTTTCCCCAGG - Intergenic
1037378396 8:18257936-18257958 CTTTTCCACAGGTTTTCAACAGG + Intergenic
1037909139 8:22733421-22733443 CTTTACCTAAGGGGTTCCCCAGG - Intronic
1038067395 8:23977162-23977184 TTTTTCCTCAGGGGGTCCCCGGG - Intergenic
1040417669 8:47209454-47209476 CTTTTTCTCAGGATCTCCTGGGG + Intergenic
1040566426 8:48571798-48571820 TTTTTCCTCAGCATTTCCTCAGG + Intergenic
1040644765 8:49385803-49385825 CTTTTCCTCATGAATTAACCAGG - Intergenic
1042040892 8:64587301-64587323 CCTTCTCTCAGGACTTCCCCTGG + Intergenic
1042933234 8:74033393-74033415 ATTTGCCTCAGTATTGCCCCAGG - Intergenic
1043019813 8:74985961-74985983 AATGACCTCAGGATTTCCCCAGG - Exonic
1043089460 8:75879139-75879161 ATTTTCCTTAAGATTTTCCCTGG - Intergenic
1043597108 8:81899578-81899600 CTATTCCTCAGGAATTTCTCAGG - Intergenic
1044024975 8:87157648-87157670 CTTTGCCTGGGGATTTCCCAGGG + Intronic
1044182221 8:89210221-89210243 CTTTTGATCAACATTTCCCCTGG + Intergenic
1044668066 8:94651118-94651140 CTTTCCCTCACCATTCCCCCTGG - Intronic
1045692989 8:104778543-104778565 CTCTGCCTCAGGATTTCTTCTGG - Intronic
1047349547 8:124060537-124060559 CTTTTCCTCAGGTTCTCTTCTGG + Exonic
1048431281 8:134373803-134373825 CTTGTCCTCATGATATCCCCAGG + Intergenic
1048829652 8:138463795-138463817 CTTCTCCTCAGGATTGCTCAGGG - Intronic
1049164777 8:141119090-141119112 CCTGGCCTCAGGCTTTCCCCTGG - Intronic
1052427870 9:28328129-28328151 CTTTTCCTAGTGATTTCCTCTGG - Intronic
1052881616 9:33604127-33604149 CCTTACCCCAGGTTTTCCCCTGG + Intergenic
1053098094 9:35346642-35346664 CTTTTCCTCAGGACTGCCTAAGG - Intronic
1053153037 9:35754826-35754848 CTTTTCCTCAGGCATTCCAGAGG + Exonic
1055391421 9:75826074-75826096 CTTTTCCTCTTGATTTTCCTAGG - Intergenic
1055637346 9:78292047-78292069 CTTTGCCTTAGTATTTCCTCTGG + Intergenic
1060126230 9:121050189-121050211 CCTGTCCCCAGGTTTTCCCCAGG + Exonic
1060677058 9:125524813-125524835 CTTTTCAGCAGGACTTCCCAGGG - Intronic
1061577537 9:131516839-131516861 CCATTTCTCAGGATTTCCCTGGG + Intronic
1185847409 X:3451003-3451025 ATTTCCCTCAGGATATCCTCAGG - Intergenic
1186422706 X:9439139-9439161 CTTTTGCTCAGGGTTTCACAAGG + Intergenic
1186673637 X:11793104-11793126 GTTTTTCTCACAATTTCCCCCGG - Intergenic
1187091878 X:16105634-16105656 CTTTTCCTGAGGATTTTCTGTGG + Intergenic
1187477622 X:19626047-19626069 CCTTTCCTCAGGAGTCTCCCCGG - Intronic
1187625853 X:21112896-21112918 CTCTTTCTCAGAATTTTCCCAGG - Intergenic
1188796806 X:34476988-34477010 CTTTTGCTTAGGATTGCCCTGGG + Intergenic
1190733093 X:53237316-53237338 CCCTCTCTCAGGATTTCCCCAGG + Intronic
1191020313 X:55852059-55852081 TTTTACCTTAGGATTTCCCTAGG + Intergenic
1191754297 X:64577421-64577443 CTTGTCCTCAGGCCTGCCCCTGG - Intergenic
1198227959 X:134663722-134663744 CTTTTCCTGAAGACTTTCCCAGG - Intronic
1200817049 Y:7544483-7544505 ATTTCCCTCAGGATATCCTCAGG + Intergenic
1201854829 Y:18529782-18529804 CTTCTCCTCAGGACTCTCCCAGG + Intergenic
1201878492 Y:18790603-18790625 CTTCTCCTCAGGACTCTCCCAGG - Intronic
1202028209 Y:20547070-20547092 CTTTTGCTCAGTATATCCCAGGG + Intergenic
1202590704 Y:26480349-26480371 ATTTTCCTCAGTATATCCCAAGG + Intergenic