ID: 908416047

View in Genome Browser
Species Human (GRCh38)
Location 1:63914385-63914407
Sequence CTTCCTAGGGAGAGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908416039_908416047 8 Left 908416039 1:63914354-63914376 CCCTGCGTGCCTGGTTTATTGTG 0: 1
1: 0
2: 1
3: 12
4: 205
Right 908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG 0: 1
1: 0
2: 5
3: 38
4: 361
908416040_908416047 7 Left 908416040 1:63914355-63914377 CCTGCGTGCCTGGTTTATTGTGT 0: 1
1: 0
2: 1
3: 28
4: 629
Right 908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG 0: 1
1: 0
2: 5
3: 38
4: 361
908416042_908416047 -1 Left 908416042 1:63914363-63914385 CCTGGTTTATTGTGTGGTTTCAC 0: 1
1: 0
2: 2
3: 18
4: 180
Right 908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG 0: 1
1: 0
2: 5
3: 38
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908416047 Original CRISPR CTTCCTAGGGAGAGGAAGGC AGG Intronic
900889604 1:5440176-5440198 CTTCCCAGGGTGGGGATGGCAGG + Intergenic
902643037 1:17778970-17778992 AGTCCTGGGGAGAGGCAGGCAGG - Intronic
903344433 1:22675397-22675419 CTTCCCAGGGAAAGGGAGACAGG - Intergenic
904883925 1:33721607-33721629 GTTCCTAAGGAGGGGAGGGCTGG - Intronic
905395445 1:37663684-37663706 CTCCCTGGGGACAGTAAGGCTGG + Intergenic
905549260 1:38823103-38823125 CTTCCTGGAGAGAGAGAGGCTGG + Intergenic
906646769 1:47480919-47480941 CATCCCAGGGAGAGAGAGGCTGG - Intergenic
908000831 1:59677300-59677322 TTTCTTAAGGAGGGGAAGGCAGG - Intronic
908248696 1:62248102-62248124 CTTCCTGGGGAAAGTCAGGCTGG - Intronic
908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG + Intronic
908474219 1:64471771-64471793 CCTCCTCGGGAGAGGAAGGAGGG + Intronic
909977311 1:82060220-82060242 CTTCCAAGGGAGATGAATGCAGG - Intergenic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911242754 1:95483409-95483431 CTTCCAGGGTAGAGGAAGGATGG + Intergenic
911506678 1:98761579-98761601 CTTTCTGGGGAGAGCAAGGCTGG - Intergenic
912648841 1:111420517-111420539 CTTCCCAGGTAGAGGACAGCAGG - Intronic
912797226 1:112700588-112700610 CCTCCAAGGGACAGGAAGGCTGG + Exonic
912805657 1:112755053-112755075 CTTTCTAGGGAGAGCAGAGCAGG + Intergenic
913198492 1:116477237-116477259 CTTCCTGGGGCCAGGAAGGGAGG + Intergenic
914704163 1:150157884-150157906 CTTCAGAGAGAGAGGCAGGCAGG + Intronic
915466077 1:156098835-156098857 CATCCTTGGGAGAGAAAGGGAGG + Intronic
915528623 1:156490755-156490777 CTTGCCAGGGAGAAGAGGGCGGG - Intronic
917147930 1:171912454-171912476 CTTCCTAGGTAGTACAAGGCTGG + Intronic
917525468 1:175784585-175784607 TTTCCTAAGGCCAGGAAGGCAGG + Intergenic
917803383 1:178591398-178591420 CTGGCTAGGGAGAGGAGGCCAGG + Intergenic
918064595 1:181090430-181090452 CTTCATTGGGAGAGAAAGGTGGG - Exonic
919586651 1:199448025-199448047 CTTCCTGGGCAGGGGAAGGGCGG - Intergenic
919972597 1:202590757-202590779 CTTCCTATGGAGACGAAGGCAGG + Exonic
920526879 1:206673756-206673778 CTTCCTAGGGAGAAAAAAGCAGG + Intronic
922355547 1:224771882-224771904 CTTATAAGTGAGAGGAAGGCAGG + Intergenic
923077644 1:230624266-230624288 CGTCATAGCGCGAGGAAGGCTGG - Intergenic
923457225 1:234174951-234174973 CCTCCTGGGGACAGGAAGGGAGG + Intronic
923464379 1:234235188-234235210 CTTGCTAGGAAGACTAAGGCAGG - Intronic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
924024736 1:239820258-239820280 CTTCTTAGGGAAAGGGAGGTAGG + Intronic
1062782406 10:226216-226238 TATACTAGGGAGAGGAAGGGTGG - Intronic
1062934340 10:1374890-1374912 CCACTTAGGGAGGGGAAGGCAGG + Intronic
1065430765 10:25653110-25653132 CTTTCTAGGGAAGGGAAGGGAGG - Intergenic
1065844420 10:29733745-29733767 CGTCCTAGGTAGAGGCAGCCAGG - Intronic
1067514527 10:46926526-46926548 TCTCCTAGGAAGTGGAAGGCAGG + Intronic
1067647733 10:48125287-48125309 TCTCCTAGGAAGTGGAAGGCAGG - Intergenic
1068291058 10:55001678-55001700 CTTCCAAGGGTGAGCCAGGCAGG - Intronic
1068377125 10:56195367-56195389 CTGGTCAGGGAGAGGAAGGCTGG + Intergenic
1068435038 10:56979681-56979703 CTTTCTAGGGAAAGAAAAGCAGG + Intergenic
1069631469 10:69899653-69899675 CCTCCTTGGGTTAGGAAGGCAGG - Intronic
1069914158 10:71776907-71776929 CTTCCCAGGTGGAGAAAGGCAGG + Intronic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1072263317 10:93702874-93702896 GTTACTAGAGAGAGGACGGCAGG - Intergenic
1072668146 10:97409443-97409465 CCTCCTAGGCTGAGGAAGACTGG + Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073086683 10:100895479-100895501 CTCCCCAAGGAGAGGAAAGCAGG - Intergenic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1075225973 10:120629203-120629225 CTTCATAGGGGGAGGAAGATGGG - Intergenic
1075469640 10:122678381-122678403 CTGCCAGGGGAAAGGAAGGCAGG + Intergenic
1076379787 10:130017166-130017188 CTGCCTGGAGAGAGGCAGGCCGG - Intergenic
1077056906 11:598205-598227 CTGGCAGGGGAGAGGAAGGCCGG + Intronic
1077093430 11:789585-789607 CTTCCCTGGGAGAGGCAGACAGG - Intronic
1077251720 11:1563699-1563721 CGTCCTGGGGAGAGGATGGTGGG + Intronic
1077870285 11:6256889-6256911 CTACCCAAGGAGAGGAAGCCAGG + Intergenic
1078142164 11:8700473-8700495 CTTCAGAGGGACAGGAACGCAGG - Intronic
1078366998 11:10715148-10715170 CTTCCCAGGAAGAGGAAGAGTGG + Intergenic
1078527072 11:12109682-12109704 CTACCTAGGCAGAGGAAAACAGG - Intronic
1079116453 11:17643442-17643464 CAACCTAGAGAGAGGAAGTCGGG - Exonic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1084192033 11:67503792-67503814 CCTCCGCGGCAGAGGAAGGCGGG - Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084430846 11:69110320-69110342 AGTTCTAGGGAGAGAAAGGCAGG + Intergenic
1084583125 11:70036927-70036949 CAGCCTCGGGAGAGAAAGGCAGG - Intergenic
1085472408 11:76766735-76766757 TTTCCTAAGGCGAGGAAGCCCGG - Intergenic
1085793475 11:79516312-79516334 CTTCCTAGGGTGAGGCAGAATGG + Intergenic
1088075980 11:105848944-105848966 CTTCCTTGGGAGGCCAAGGCAGG + Intronic
1089075442 11:115734755-115734777 CTTCCTCTGCAGGGGAAGGCAGG + Intergenic
1089253246 11:117179875-117179897 CTCCCCAGGGAGATGAATGCAGG + Intronic
1089254502 11:117187178-117187200 TTTCCATGGGAGAGGCAGGCAGG + Intronic
1089302465 11:117506966-117506988 ATTTCTAGCGGGAGGAAGGCTGG - Intronic
1089362145 11:117898051-117898073 CTTCCTAGGGACAGGAAGCCTGG + Intergenic
1089623778 11:119738328-119738350 CGGCCTAGGAACAGGAAGGCAGG + Intergenic
1091038366 11:132254225-132254247 CTCCCCAGGGAGGGGCAGGCAGG - Intronic
1091628643 12:2141539-2141561 GTTGCTAGGGAAATGAAGGCTGG - Intronic
1091999751 12:5022495-5022517 CTTCCTGGAGACAGGAAGGTAGG + Intergenic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1093669575 12:21857717-21857739 CTTCAAAGGTGGAGGAAGGCAGG + Intronic
1097131775 12:56816530-56816552 CTTCCTAGGAGGAGGAAGAAGGG + Intergenic
1098773291 12:74581989-74582011 CTTCCCAGGGAAAGGAACCCAGG + Intergenic
1099244480 12:80179006-80179028 CTTTCTAAGAAGAGTAAGGCAGG + Intergenic
1102239775 12:111317567-111317589 CATCTCTGGGAGAGGAAGGCAGG - Intronic
1102508366 12:113398180-113398202 GCTCCTAGGGAGACTAAGGCAGG - Intronic
1102698948 12:114822648-114822670 CCTCCTGGGGAGACTAAGGCAGG - Intergenic
1103198881 12:119070038-119070060 TTGCCTTGGGAGAGGAATGCAGG + Intronic
1103356817 12:120327674-120327696 CTCACTTGGGAGAGAAAGGCGGG + Intronic
1103956361 12:124579079-124579101 CTTCCTTGTGAGAGGGAGTCAGG - Intergenic
1104608436 12:130206743-130206765 CGTAATAGAGAGAGGAAGGCAGG + Intergenic
1104968980 12:132522706-132522728 CTTCCTGGGGTGGGGAAGGAAGG - Intronic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1105920165 13:24955959-24955981 CTCCCAAGGGAGAGGGAGGGTGG + Intergenic
1106504952 13:30363067-30363089 TTTGCCAGGGAGAGGAGGGCGGG - Intergenic
1107014883 13:35700371-35700393 CTCCCTCTGGAGTGGAAGGCAGG - Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107765924 13:43734518-43734540 TTTCCTTAGGAAAGGAAGGCAGG - Intronic
1109829673 13:67770338-67770360 ATTCCTAGGCAGACAAAGGCAGG - Intergenic
1110081156 13:71314672-71314694 GTTCCTAGAGAGAGAAAAGCAGG + Intergenic
1110760485 13:79225259-79225281 CTTCCTAGGGAGGGGGAGGAGGG + Intergenic
1111007050 13:82261758-82261780 TTTCCTAGGGAGAAGAAGCTTGG + Intergenic
1111946139 13:94667824-94667846 CCTACTAGGGAGACTAAGGCGGG + Intergenic
1112895315 13:104292470-104292492 GTTCCTTGTGAGAGGGAGGCAGG - Intergenic
1113170280 13:107493628-107493650 AATCCCAGGGAGAGTAAGGCAGG + Intronic
1113343991 13:109455834-109455856 CATCGGAGGGAGAAGAAGGCAGG - Intergenic
1114267130 14:21079433-21079455 CTTCCAAGGGAGAGGGAGGTGGG - Intronic
1114643445 14:24240262-24240284 CCTCCTAGGGCCAGGAAGCCAGG - Exonic
1115525582 14:34277258-34277280 CTTTTTAGGGAGTGGGAGGCAGG - Intronic
1118501014 14:66362741-66362763 CTTCATGTGGAGATGAAGGCAGG - Intergenic
1119185728 14:72641058-72641080 CATCCAAGGAAGAGGAAGGGTGG + Intronic
1119263232 14:73250504-73250526 CTTTCTAGGGAGCAGAAGGTCGG - Intronic
1119415520 14:74466950-74466972 TTTCTGAGGGAGAGGAAGGAAGG - Intergenic
1119899129 14:78244870-78244892 CTTCCCAGGGAGAAGCAGGGAGG + Intronic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1122981185 14:105193009-105193031 CTTCCTGGGAAGAGGAGGGAGGG + Intergenic
1126096154 15:45092156-45092178 CTTACTAAGGGCAGGAAGGCTGG + Intergenic
1127372922 15:58357105-58357127 CCTCCTAGGAAGAGAAAGGTGGG + Intronic
1128113844 15:65093418-65093440 TTTCCTTGGCAGAGGAAGGGAGG - Intronic
1128499149 15:68214988-68215010 CTTCCCAGAGAGAGGAAGGCAGG + Intronic
1130522023 15:84669992-84670014 CTTCCCAGGAACAGCAAGGCAGG + Exonic
1131057980 15:89387412-89387434 CTTCCTAGGGAAGGAAAGGTTGG - Intergenic
1131400902 15:92124883-92124905 TGTCCTAGGGAGAGAAAGGAGGG + Intronic
1131932607 15:97461010-97461032 ATTCCTGGGGAGAGGGAGGAGGG + Intergenic
1132591280 16:727414-727436 CTTCCTAGGGTGTGGAGAGCGGG + Exonic
1133087792 16:3378598-3378620 CTTCTTAGAGGGAGGAAGGATGG - Intronic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1133460095 16:5980062-5980084 GTTCCTAGAGAGAGGGAGGAGGG - Intergenic
1134821913 16:17253799-17253821 GTTGCAAGGGAGAAGAAGGCAGG - Intronic
1134862600 16:17574043-17574065 CTGGCAAGGGAGAGGATGGCCGG + Intergenic
1135003849 16:18801311-18801333 CTGCCCAGGGAGAGAAGGGCCGG + Intronic
1137591139 16:49694680-49694702 CCTCCAAGGGAAAGGAAGGGAGG + Intronic
1137708578 16:50551184-50551206 GTTCCCAGCGAGAGGAATGCAGG + Intronic
1137846789 16:51697753-51697775 CTTGGTAGGTAGAGTAAGGCTGG - Intergenic
1137924719 16:52529469-52529491 CTTCCTTTGTAGAGAAAGGCAGG - Intronic
1139381720 16:66536652-66536674 CTTCTAGGGGAGGGGAAGGCTGG + Intronic
1140415960 16:74774289-74774311 GTTCCTGGAGAGAGGAAGGAGGG + Intronic
1141165510 16:81658079-81658101 CTGCCTAGGGAGTTGAAGGCAGG + Intronic
1142078151 16:88132238-88132260 CTTCCTGGGTGCAGGAAGGCGGG - Intergenic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142231501 16:88902217-88902239 CTGCCCAGGGAGAGGCCGGCAGG + Intronic
1142371774 16:89686610-89686632 GTTGCTAAGGAGAGGAAGCCCGG + Intronic
1143067839 17:4263842-4263864 CTGCCGTGGGAGGGGAAGGCCGG - Exonic
1143782692 17:9237702-9237724 AGTCCTGGGGAGAGGAAAGCGGG + Intronic
1143833471 17:9670977-9670999 CTCCCCAGGGAGAGGAAGCCAGG - Intronic
1144577236 17:16436808-16436830 CCTCCTTGGGAGGGGAAGCCAGG - Exonic
1144642252 17:16944009-16944031 CTTGGTGGGGAGAGGAGGGCAGG - Intronic
1145347556 17:22050485-22050507 CTCCCTGGGAAGAGGAAGGGAGG + Intergenic
1145416028 17:22714843-22714865 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147331755 17:39703392-39703414 CTTCCCAGGGGGAGGATGGGTGG - Intronic
1149143803 17:53465671-53465693 CTTGGTAGGGAGAGGTAGACAGG + Intergenic
1149291839 17:55225202-55225224 CTGCCTAGGGAGAGGGAGCCAGG - Intergenic
1149862238 17:60128504-60128526 GTTTCCAGTGAGAGGAAGGCAGG - Intergenic
1151404368 17:73877198-73877220 GCTGCAAGGGAGAGGAAGGCAGG - Intergenic
1151482842 17:74380300-74380322 CTTCGGAGGGAGGGGCAGGCAGG + Intergenic
1151496306 17:74460250-74460272 CCTCCAAGGGAGAGGAAGAGTGG - Intergenic
1151587521 17:75019241-75019263 CCTCCTAGGGGGAGACAGGCAGG + Intronic
1153160200 18:2196232-2196254 CTTTCCAGGAAGAAGAAGGCTGG + Intergenic
1153382003 18:4450813-4450835 AATCCTAGGGAGAGGGAGGAAGG + Intronic
1153499955 18:5738412-5738434 CTTCCCAGAGAGAGGAAGACAGG - Intergenic
1154111068 18:11568761-11568783 CTCCCCTGGGAGAAGAAGGCAGG - Intergenic
1154156920 18:11951110-11951132 CTTCCTTCAGAGAGGGAGGCGGG + Intergenic
1154503205 18:15006702-15006724 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1155318167 18:24592724-24592746 CCACCTTGGAAGAGGAAGGCAGG + Intergenic
1155341872 18:24821274-24821296 CTTCCTTGGGAGGGCAAGGAGGG + Intergenic
1155647605 18:28098605-28098627 GTTCCTAAGCACAGGAAGGCTGG - Intronic
1155676124 18:28430959-28430981 GTTACTAGGGAGAAAAAGGCAGG - Intergenic
1155847778 18:30731175-30731197 CTTCCTAGGTGGTGGAAGGGAGG + Intergenic
1156509049 18:37620096-37620118 ACTCCAAGGGAGAGGAAGCCTGG + Intergenic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158334430 18:56400190-56400212 CTTCCTAGAGCGAGGAGTGCTGG - Intergenic
1159450755 18:68599124-68599146 AGCCCTAAGGAGAGGAAGGCAGG + Intergenic
1160433326 18:78827278-78827300 CTTCCCGGGGTGAAGAAGGCCGG + Intergenic
1160502657 18:79410111-79410133 CTTCCCAGGGAGAGGCGGCCGGG - Intronic
1160533299 18:79577724-79577746 CCACCCAGTGAGAGGAAGGCTGG - Intergenic
1160564912 18:79781037-79781059 CTTCATAGGGAGAAAAAGGAGGG - Intergenic
1161118354 19:2511882-2511904 CTTCCTGGAGAGAGGAGGGCAGG + Exonic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1162330745 19:10027744-10027766 GATCCCAGGGAGGGGAAGGCGGG + Intergenic
1163363867 19:16865391-16865413 CTAACTATGGAAAGGAAGGCAGG - Exonic
1163791103 19:19306515-19306537 CATCCTAGAATGAGGAAGGCTGG - Intronic
1164589843 19:29500709-29500731 CTCCCTAGGGTGATGAAGGCTGG + Intergenic
1164674613 19:30093030-30093052 CTCCCTTGGGAGAGTCAGGCTGG - Intergenic
1166746306 19:45143455-45143477 CTTCCTGGGGAGGGGACTGCAGG - Intronic
1166963321 19:46513142-46513164 CTTCCCAGGGAGAGGACGAGTGG + Intronic
1168059633 19:53883563-53883585 CGTCCTAGGCAGGGGCAGGCCGG + Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
925889988 2:8425887-8425909 CTGCCTAGGGACATGATGGCAGG + Intergenic
926135411 2:10332471-10332493 CTGCCTAGGGTGGGCAAGGCAGG + Intronic
927373831 2:22389809-22389831 CTTCATAGAGGAAGGAAGGCAGG + Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
928123153 2:28598518-28598540 CTTCCTGGGGAGAGGCAGGGAGG - Intronic
928198320 2:29230571-29230593 CTTGCTAGAAAGAGGAAGCCAGG + Intronic
928229862 2:29488813-29488835 CTTCCTAGGTGGAGGAAGACCGG - Intronic
928300385 2:30119004-30119026 CTTCCTAGGGAAATTGAGGCTGG + Intergenic
930218080 2:48717704-48717726 CTTCCTGGGCAGAGCAAGTCAGG + Intronic
930777688 2:55190504-55190526 CTTACGAGGGAGAGGAAAGATGG + Intronic
930978630 2:57494882-57494904 CTTCCTTATGAGAGGAAGGCAGG + Intergenic
932346430 2:70998616-70998638 CTTCCTAGGAAGAGAAGGGGTGG + Intergenic
932883471 2:75525967-75525989 CTGCCTTGGGATAGGAAGGTAGG - Intronic
933766934 2:85716008-85716030 CTTCTAAGGAAGAGTAAGGCTGG + Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
937044623 2:118844650-118844672 CTAGCTACAGAGAGGAAGGCTGG + Intronic
938241692 2:129747389-129747411 GATCCTAGGGAGGAGAAGGCAGG + Intergenic
938502385 2:131836863-131836885 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
938572166 2:132570682-132570704 CTGCCGAGGGCTAGGAAGGCTGG - Intronic
938603826 2:132872077-132872099 CTTTCTCTGGAGAGGAAAGCTGG - Intronic
940454760 2:153882738-153882760 CTTCCTTGGGAGGCTAAGGCAGG - Intronic
942493658 2:176516214-176516236 CTTTCTTGGGAGAGCAGGGCAGG + Intergenic
943974200 2:194449906-194449928 CTTCCTTGGGAGAGTAAAGGTGG - Intergenic
944291176 2:198006888-198006910 CTTCCTAGGAAAATGAAAGCAGG - Intronic
946083789 2:217150723-217150745 CTTTCTATGGAGCGGTAGGCTGG + Intergenic
946182583 2:217957382-217957404 CTTCCTGGGGACAGGACGGTGGG + Intronic
947102051 2:226631204-226631226 CTTCCTAGGGAGAGGAAGAGAGG + Intergenic
947622155 2:231597565-231597587 CTTCCTAGGGGAAGGGATGCTGG + Intergenic
948652093 2:239453552-239453574 TTTCATTGGGAGATGAAGGCAGG - Intergenic
948757383 2:240167484-240167506 CTGCCCAGGGTGAGGAAGTCCGG - Intergenic
948938954 2:241186761-241186783 CTTCTGAGGGAAAGGAAGGAAGG - Intergenic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169384381 20:5135842-5135864 GTCCCTGGGGAGAGGCAGGCGGG - Intronic
1169393976 20:5213690-5213712 CTTCCTAGGGACAGACAGGGAGG - Intergenic
1169742160 20:8906764-8906786 CTGCAAGGGGAGAGGAAGGCAGG + Intronic
1169858898 20:10131769-10131791 CTCTCTAGAGAGAGGCAGGCTGG - Intergenic
1170662727 20:18358691-18358713 CATCCCAAGGAGAGGAAGGAGGG - Intergenic
1170859530 20:20089864-20089886 CTTGCCATGGAGGGGAAGGCTGG - Intronic
1171005871 20:21465386-21465408 CATCCTGGGAAGAGGATGGCAGG - Intergenic
1171519335 20:25764234-25764256 CTCCCTGGGAAGAGGAAGGGAGG - Intronic
1171557586 20:26092257-26092279 CTCCCTGGGAAGAGGAAGGGAGG + Intergenic
1172681205 20:36716730-36716752 CCTAGTAGGTAGAGGAAGGCAGG + Intronic
1172683695 20:36737268-36737290 CTTCTTCAGGAGTGGAAGGCAGG - Intronic
1172690573 20:36786634-36786656 CGTCCTAGGAAGAGGGAGGCAGG + Exonic
1172696719 20:36828072-36828094 CGCCCTCGGGGGAGGAAGGCAGG + Intronic
1173046856 20:39521068-39521090 CAACCGAGGGAGAGGAGGGCAGG - Intergenic
1173322901 20:42005298-42005320 CTTCCTTGAGGGAGGCAGGCTGG + Intergenic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174137365 20:48389473-48389495 CATCCAAGGGTGAAGAAGGCAGG + Intergenic
1174518821 20:51114082-51114104 CTTACTAGAGTGAGGCAGGCAGG - Intergenic
1175639145 20:60612486-60612508 CTTTCTAGGGATTGGATGGCTGG - Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1176206523 20:63891627-63891649 CACCCTTGGGAGAGGCAGGCAGG + Intergenic
1176653479 21:9570515-9570537 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1177268147 21:18810397-18810419 CTTTCTGGGGAGAGGAATTCAGG - Intergenic
1178379601 21:32096708-32096730 CATCCTAGGGGGAGGAGGGAAGG - Intergenic
1178725310 21:35046260-35046282 CTTCCTTGAGAGAGGCAAGCCGG - Intronic
1178838378 21:36117833-36117855 ATTCCTTGGCACAGGAAGGCTGG - Intergenic
1179187882 21:39098541-39098563 CTTCTCAGGGAGAGGCAGCCAGG + Intergenic
1179887194 21:44319206-44319228 GTTCCTAGGGAGAGGCTGCCAGG + Intronic
1180132916 21:45838144-45838166 CTTCACAGGGAGAGAAAAGCAGG - Intronic
1180698603 22:17769799-17769821 CTGCCTAGAGACAGGAAGGTGGG - Intronic
1182366798 22:29784599-29784621 GTCCCCAGGGAGAGGAAGGGTGG - Intergenic
1183323301 22:37178031-37178053 CTTCCTGGGGAGATGAGCGCAGG - Intergenic
1183334754 22:37240233-37240255 TCTCCTAGGAAGAGGAGGGCAGG - Intronic
1183511087 22:38235349-38235371 CTTTCTTGGGAGAGGACTGCAGG - Intronic
1183715774 22:39532673-39532695 CGTCCGAGGGTGAGGAGGGCTGG - Exonic
1183952914 22:41361925-41361947 CTGCCTTGGGAGATCAAGGCAGG + Intergenic
1183985723 22:41569106-41569128 CTCCCTAGAGAGAGGGAGGCAGG + Intronic
1184249839 22:43253771-43253793 CTTCCCAGGAAGAGGATGGGTGG - Intronic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
950501319 3:13365669-13365691 CTTCGTTGGGAGAGGCTGGCAGG + Intronic
954109821 3:48427762-48427784 CTCCCCAGGGAGAGGATGGTTGG - Intronic
954391426 3:50269904-50269926 CCCCCCAGGAAGAGGAAGGCAGG - Intronic
954793677 3:53150477-53150499 CTTCCTTGGGACAGGGAAGCTGG + Intergenic
955015896 3:55068368-55068390 CTTCCTATAGAGAAGAAGGAAGG - Intronic
955572095 3:60319021-60319043 CTTTGTAAGAAGAGGAAGGCAGG - Intronic
961478304 3:127162945-127162967 CTCCTTAGGGAGAGGAAGCCAGG - Intergenic
961650419 3:128414195-128414217 CTACCAAGGTAGAGGCAGGCTGG + Intergenic
962342823 3:134599296-134599318 CTTCCTAAGGAGAAGCATGCTGG + Intronic
962661574 3:137606284-137606306 TTTCTGAGGTAGAGGAAGGCAGG - Intergenic
962677507 3:137767914-137767936 CTTCCTAGGGGGCGGGAGGAGGG - Intergenic
963600119 3:147371682-147371704 CTTCCTTTGGAAAGGAAGGAAGG + Intergenic
963947890 3:151166487-151166509 CTACCTAGAGAGAGAAAGGGGGG + Intronic
964006387 3:151834410-151834432 TTTCCTAGAGAGTAGAAGGCAGG + Intergenic
964164224 3:153682064-153682086 CTTCATGGGGAGGGGAAGGGGGG + Intergenic
965516439 3:169626602-169626624 ATCACGAGGGAGAGGAAGGCTGG - Intronic
966413034 3:179662847-179662869 GTCCATAGGGAGAGGAATGCAGG - Intronic
967862105 3:194160092-194160114 TTTCCTAGAGTGAGGAAGGAGGG + Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968268018 3:197377574-197377596 CTTTCTAGGGCGAGGAGAGCTGG + Intergenic
969227474 4:5808182-5808204 CATCCTGGGGGGAGGAAGGCAGG - Exonic
969515972 4:7648464-7648486 ACTCCCAGGCAGAGGAAGGCGGG - Intronic
969556083 4:7911225-7911247 CTCCTTAGGGACAGGAATGCAGG - Intronic
971380016 4:26088019-26088041 ATACCTGGGGATAGGAAGGCAGG + Intergenic
972204478 4:36755281-36755303 CTCCCAAGGGAGAGGGAGGTGGG + Intergenic
972633867 4:40865200-40865222 CTTTCCAGGGAGAGCAAGCCAGG - Intronic
973230751 4:47837155-47837177 CTGCCTAGGCACAGGAGGGCTGG - Intronic
976601151 4:86938336-86938358 CTTCCTCGGGAGGCTAAGGCAGG + Intronic
977784724 4:101019427-101019449 CTTCCTACCTAGAGGAAAGCTGG - Intergenic
979503439 4:121466675-121466697 CTTTCTAGGGAGAGCAAGGCCGG + Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983436267 4:167719842-167719864 CTTCCTATGGAGAGAAAGTAAGG + Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
985099119 4:186440413-186440435 GTTGAAAGGGAGAGGAAGGCTGG + Intronic
985884016 5:2662350-2662372 CTTCCTAGGGAGAAAAAAGCAGG - Intergenic
986280295 5:6316780-6316802 CTTTCTGGGTCGAGGAAGGCAGG - Intergenic
988479482 5:31618169-31618191 CTGCCTAGAGAGAGGAATACTGG - Intergenic
990596279 5:57315336-57315358 CTTTTTAAGGAAAGGAAGGCAGG - Intergenic
992014860 5:72565478-72565500 ATTCCCAGGGAGAGAAAGGCAGG - Intergenic
992106401 5:73451827-73451849 CTCCTTAGGGGGATGAAGGCTGG + Intergenic
993857662 5:93096278-93096300 CTTCCTAGGGACAGTGGGGCAGG - Intergenic
994059354 5:95456749-95456771 CCTCCTTGAGAGAGGAAGGATGG + Intergenic
995440969 5:112191857-112191879 TTTCCTAGAGACAGGAAAGCAGG + Intronic
996141430 5:119913817-119913839 GGTCCTTGGGAGTGGAAGGCAGG - Intergenic
996421149 5:123264106-123264128 GCTACTATGGAGAGGAAGGCTGG + Intergenic
996503321 5:124240819-124240841 CTTCATATGGAGAGGAAAGATGG + Intergenic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
997830580 5:137146241-137146263 GTTCCTGGGGAGAGGGAGGAAGG - Intronic
998298183 5:140992218-140992240 CTTCCTGGGAAGAGTAAGGAAGG + Intronic
1002194435 5:177494585-177494607 CTTCCCAGAGTGAGGAGGGCAGG + Intronic
1002317950 5:178356562-178356584 CTTCCCAGAAAGAGAAAGGCAGG + Intronic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1002846956 6:955484-955506 GGTCCTTGTGAGAGGAAGGCAGG + Intergenic
1003133934 6:3418570-3418592 CCTGGTAGGGAGAGGAAGCCTGG + Intronic
1003493688 6:6645525-6645547 CTTCCTAGGTCAAGGAAGGAAGG + Intronic
1004297029 6:14422381-14422403 CTTCCTTGGTAGAGGAAAGCTGG + Intergenic
1006107843 6:31727464-31727486 TTTCCTAGTGGGAGGAAGGAAGG - Intronic
1007464384 6:42041793-42041815 CTTCCCAGGGACAGGCAGACTGG + Intronic
1007729756 6:43938806-43938828 GGTCTTGGGGAGAGGAAGGCTGG - Intergenic
1007733780 6:43967873-43967895 CTTCCCCGGGGGAGGCAGGCTGG - Intergenic
1008010874 6:46466418-46466440 CTGCCTAGGGAGTGGAGAGCTGG + Intronic
1008741548 6:54615019-54615041 CTTCCTGGGCAGGGGAAGGTTGG + Intergenic
1009958061 6:70480897-70480919 CTTCACAGGGCGAGGAAAGCTGG - Exonic
1011598496 6:89038659-89038681 CTTCTTAGGGAAAGGGAGGTAGG - Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1013445645 6:110223552-110223574 CTTGCTTAGGAGAGGAAGGGAGG + Intronic
1013518549 6:110911932-110911954 CTTCTTTGGGAGAGTGAGGCAGG - Intergenic
1013839057 6:114368343-114368365 TCTCCTAGAAAGAGGAAGGCCGG + Intergenic
1014308742 6:119772204-119772226 CTTCCTAGGGAGCAGAGGACAGG + Intergenic
1014941080 6:127439635-127439657 CTTCCTTGGGAAAAGAAGGCTGG + Exonic
1017056032 6:150436313-150436335 CTTCCTATGGTGCGGAAGGGGGG - Intergenic
1017619974 6:156286662-156286684 GTTCCTGGTGAGGGGAAGGCTGG - Intergenic
1018061017 6:160089788-160089810 TTTCCTAGGGAAAGGAAGCACGG - Intronic
1018629617 6:165810677-165810699 CATCCTGGGGAGAGGAAGGTAGG - Intronic
1019078759 6:169412911-169412933 GTTCCTAAGGAGAGTAAAGCTGG + Intergenic
1019295565 7:272250-272272 CATCCCAGGGAGAGGAAATCTGG - Intergenic
1019454968 7:1122267-1122289 CTTACGAGGCAGAGGAAGCCAGG + Intronic
1019655576 7:2193116-2193138 CTTCCCAGGGGCAGGGAGGCTGG + Intronic
1023570954 7:41571320-41571342 CTTGTGAGGGAGAGGAAGGTGGG + Intergenic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1023897833 7:44448950-44448972 CTTCCTAGAGAAAGGAGGTCAGG + Intronic
1024624084 7:51189271-51189293 CTTGGCGGGGAGAGGAAGGCTGG + Intronic
1024974051 7:55096995-55097017 CTTACTAGGGAAAGGGAGCCAGG - Intronic
1025279818 7:57619174-57619196 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1025304914 7:57846327-57846349 CTCCCTGGGAAGAGGAAGGGAGG + Intergenic
1026907135 7:74069022-74069044 CTTCCTGGGGGGAGGGAGGAGGG + Intronic
1026944341 7:74306467-74306489 CATCCTGGGGCGAGGGAGGCAGG - Intronic
1029930743 7:104368024-104368046 ATTCCTAATGAGAGGAAAGCTGG - Intronic
1030019771 7:105261883-105261905 CTTCCTTGAGACAGGAAGGATGG + Intronic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1032280883 7:130500297-130500319 CTTCCTTGAGAGAAGAATGCGGG + Intronic
1033130755 7:138743617-138743639 CTTCCTTGGGAGAGGAAGAATGG + Intronic
1033282724 7:140017415-140017437 ATTCCTAAGGAGAGGCAGGGAGG + Intronic
1033390826 7:140925247-140925269 AATCCTAGAGGGAGGAAGGCGGG + Intergenic
1033719488 7:144042865-144042887 CTTCCTAGGGATAGGTAGACTGG + Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034461786 7:151201688-151201710 CTTGAGAGAGAGAGGAAGGCGGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1038399494 8:27272153-27272175 CTTCCTGTGAGGAGGAAGGCAGG - Intergenic
1038403047 8:27300017-27300039 CAAGCTAGAGAGAGGAAGGCAGG - Intronic
1039462173 8:37754262-37754284 CTTTCTAGGGAAAGGAGGGTGGG + Exonic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1040747657 8:50664735-50664757 CTTCCTAGTGAGAGGAAGATCGG + Intronic
1040795064 8:51281440-51281462 CTGCCTAGGGAGAGCAAAGTTGG + Intergenic
1042188135 8:66157195-66157217 CTGCCTAGGGAGAGGAGGGTGGG + Intronic
1042877385 8:73451657-73451679 CTTCTCAGGGTGAGGAAGGTGGG + Intronic
1042984292 8:74566202-74566224 CTCCCTTGGGAGACCAAGGCGGG - Intergenic
1044526588 8:93259575-93259597 CTTCCTAGGGAGTGGGACCCAGG + Intergenic
1046953601 8:120041411-120041433 CTTCCTATCAGGAGGAAGGCTGG + Intronic
1047436483 8:124839323-124839345 GTGCCCAGGGAGAGGCAGGCTGG - Intergenic
1047782738 8:128123227-128123249 CTCCATAGGGGGAGGAAGGAGGG - Intergenic
1048287187 8:133151044-133151066 CTTCCTAGAGAGGCCAAGGCAGG - Intergenic
1049050456 8:140190718-140190740 CTTTCTAGAGTGAGGAAGGAGGG - Intronic
1049468321 8:142763875-142763897 TTTCCTAGAGAGGGGCAGGCCGG + Intergenic
1049514390 8:143045697-143045719 CTTGCCAGAGAGAGGAAGGTGGG + Intronic
1051203580 9:14659938-14659960 CTTCCTGGGGACAGGAAAGATGG - Intronic
1053119783 9:35538067-35538089 CTCCCCAGGGAAAGGAAGGCAGG - Intronic
1054961553 9:70975726-70975748 CTGCCTACTGAGAGGAAGGCTGG - Intronic
1055649060 9:78389310-78389332 TTCCCTAGGGAGAGCAGGGCAGG - Intergenic
1056030607 9:82549476-82549498 CTTCCTGAGGAGAGTAGGGCAGG + Intergenic
1056939908 9:90946176-90946198 CTTCCTATTGAGAAGAGGGCAGG + Intergenic
1057875355 9:98749397-98749419 GTTCACGGGGAGAGGAAGGCAGG - Intronic
1058106650 9:100979488-100979510 CTTCCAGAGGAGAGGAAGGTTGG + Intergenic
1058723462 9:107779863-107779885 TTTCCTAAGGACAGGATGGCTGG + Intergenic
1058743002 9:107963223-107963245 CCTCCTACGGAGAGGAATCCCGG - Intergenic
1058947817 9:109875324-109875346 CTGCCTAGGAAGAGGTAGACAGG - Intronic
1060069600 9:120534503-120534525 ATTCCTGGGGAGAGGAACCCAGG + Intronic
1061160736 9:128892501-128892523 CTTCCTGGGGAGAGGAAGAGGGG - Intronic
1062278848 9:135743110-135743132 CCTCCCAGGGACAGGCAGGCAGG + Intronic
1062532973 9:137009764-137009786 CTTACCAGGAAGATGAAGGCTGG + Exonic
1203631199 Un_KI270750v1:73962-73984 CTCCCTGGGAAGAGGAAGGGAGG - Intergenic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1186516051 X:10166815-10166837 CATCCCAGGGACAGGAGGGCTGG - Intronic
1189158756 X:38788290-38788312 CTTACTAGGGAGACTGAGGCAGG + Intergenic
1189669421 X:43392134-43392156 CTTCATAGGGAGAGAAAAGTTGG - Intergenic
1191851592 X:65589583-65589605 CTGGGAAGGGAGAGGAAGGCAGG + Intronic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1198030110 X:132746613-132746635 CTTCCTAGGCAGAGGGAGTGAGG - Intronic
1198174994 X:134146244-134146266 GTTTGTAGGTAGAGGAAGGCAGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198402105 X:136278374-136278396 CTTCCTAGGGGAAGGAGGTCAGG - Intergenic
1199680286 X:150219764-150219786 CTGCGGAGGCAGAGGAAGGCTGG + Intergenic
1199773291 X:150989015-150989037 CTTCCAAGGTATAGGAAGGTGGG + Exonic