ID: 908416105

View in Genome Browser
Species Human (GRCh38)
Location 1:63914848-63914870
Sequence CTTCCATGCACCTTGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908416101_908416105 10 Left 908416101 1:63914815-63914837 CCCCAAGGCAGAATCAGTCTCTC 0: 1
1: 0
2: 2
3: 21
4: 227
Right 908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG No data
908416099_908416105 29 Left 908416099 1:63914796-63914818 CCATTTCTGCTTCATCTCTCCCC 0: 1
1: 0
2: 9
3: 115
4: 937
Right 908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG No data
908416102_908416105 9 Left 908416102 1:63914816-63914838 CCCAAGGCAGAATCAGTCTCTCT 0: 1
1: 0
2: 3
3: 26
4: 252
Right 908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG No data
908416103_908416105 8 Left 908416103 1:63914817-63914839 CCAAGGCAGAATCAGTCTCTCTT 0: 1
1: 0
2: 1
3: 26
4: 251
Right 908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG No data
908416098_908416105 30 Left 908416098 1:63914795-63914817 CCCATTTCTGCTTCATCTCTCCC 0: 1
1: 0
2: 3
3: 49
4: 601
Right 908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908416105 Original CRISPR CTTCCATGCACCTTGGCTGA TGG Intronic
No off target data available for this crispr