ID: 908421406

View in Genome Browser
Species Human (GRCh38)
Location 1:63962106-63962128
Sequence AAAAGTTATCTGGGCATGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2517
Summary {0: 1, 1: 0, 2: 55, 3: 645, 4: 1816}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908421399_908421406 21 Left 908421399 1:63962062-63962084 CCAGCCTGGGCAACATGGCAAAA 0: 5847
1: 27241
2: 64012
3: 195381
4: 302887
Right 908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG 0: 1
1: 0
2: 55
3: 645
4: 1816
908421401_908421406 -2 Left 908421401 1:63962085-63962107 CCCCATGTCTACTAAAAATACAA 0: 1150
1: 88102
2: 176243
3: 171464
4: 104161
Right 908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG 0: 1
1: 0
2: 55
3: 645
4: 1816
908421403_908421406 -4 Left 908421403 1:63962087-63962109 CCATGTCTACTAAAAATACAAAA 0: 2995
1: 205611
2: 139830
3: 62519
4: 41655
Right 908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG 0: 1
1: 0
2: 55
3: 645
4: 1816
908421400_908421406 17 Left 908421400 1:63962066-63962088 CCTGGGCAACATGGCAAAACCCC 0: 2928
1: 17678
2: 47547
3: 140385
4: 237725
Right 908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG 0: 1
1: 0
2: 55
3: 645
4: 1816
908421402_908421406 -3 Left 908421402 1:63962086-63962108 CCCATGTCTACTAAAAATACAAA 0: 1217
1: 94042
2: 246506
3: 151734
4: 74243
Right 908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG 0: 1
1: 0
2: 55
3: 645
4: 1816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908421406 Original CRISPR AAAAGTTATCTGGGCATGTT AGG Intronic
Too many off-targets to display for this crispr