ID: 908429376

View in Genome Browser
Species Human (GRCh38)
Location 1:64041006-64041028
Sequence GTCTCAAGTCAATTAATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908429372_908429376 10 Left 908429372 1:64040973-64040995 CCTTTGGTGTGGGAAGGAGGTTT No data
Right 908429376 1:64041006-64041028 GTCTCAAGTCAATTAATAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908429376 Original CRISPR GTCTCAAGTCAATTAATAGT GGG Intronic
901083214 1:6595358-6595380 GTCTCATCTCAATTAATAGAAGG - Intronic
904089989 1:27938026-27938048 ATCTCCAGGCAATTAAAAGTGGG + Intronic
906384074 1:45352330-45352352 GTCTCAAGTCAGTTGACACTGGG + Intronic
906629734 1:47356661-47356683 GTCTCAAATAAATAAATAGAAGG - Intronic
908056446 1:60292285-60292307 CTCTCAAGTCAATTAGTATGAGG + Intergenic
908429376 1:64041006-64041028 GTCTCAAGTCAATTAATAGTGGG + Intronic
915966448 1:160312989-160313011 GTCTCTAGTAAATGTATAGTAGG - Intronic
916767266 1:167873441-167873463 GTGTCAAGGCAATTAAGAGGAGG - Intronic
924072513 1:240296550-240296572 GTCTCAAGTCAAATAATTCTTGG + Intronic
924181608 1:241444522-241444544 GTCTCAAGTGAATGAGTAGGAGG + Intergenic
1066585427 10:36929038-36929060 GTTTTAAGTCATTTAATATTTGG - Intergenic
1068293522 10:55036115-55036137 GTCTCAAGTCCTTTCATAATGGG - Intronic
1070233693 10:74600365-74600387 GTCTTTAGTCTATTAATAGAAGG - Exonic
1075757261 10:124822954-124822976 GTCTCAAAACAGTTAAAAGTTGG + Intronic
1079834306 11:25313695-25313717 TTCTTAAGTCAAATCATAGTTGG - Intergenic
1081007379 11:37762520-37762542 GTCTCATCTAAATTAGTAGTGGG - Intergenic
1083903176 11:65653732-65653754 TTCTCAAGTGCCTTAATAGTAGG - Exonic
1085922943 11:80980807-80980829 TTCTCAAGTCACTTAACATTTGG - Intergenic
1101324631 12:103704258-103704280 GGCCCAATTCACTTAATAGTTGG + Intronic
1104318504 12:127726996-127727018 GTCTCAGGGCAATTCAAAGTAGG + Intergenic
1106788911 13:33134878-33134900 CTCTCAAGACTATTAATAGCAGG - Intronic
1107539169 13:41369926-41369948 GTTTTAAGTCAATAAATATTTGG + Intronic
1109550469 13:63891673-63891695 CTGTAACGTCAATTAATAGTGGG + Intergenic
1113082159 13:106531725-106531747 GTATCAAGTCAATTAGTATCAGG + Intronic
1115819175 14:37195675-37195697 TTCTCAAGTCTATAAATATTAGG - Intergenic
1116039904 14:39673449-39673471 GTCTCCAGTGAAATAAGAGTTGG - Intergenic
1121053980 14:90838081-90838103 GTCTCAAATAAATAAATAGAAGG + Intergenic
1125958979 15:43812665-43812687 GTTTCAAGTCACTCAATTGTGGG + Intronic
1132102653 15:99035863-99035885 GTCTCAAGTTAAATAAAAGAGGG - Intergenic
1132370205 15:101291767-101291789 GTCAAAAGTCAAGTAAAAGTAGG + Intronic
1133508207 16:6432677-6432699 GTCTCAAGAAAAATAATAATAGG + Intronic
1134330437 16:13245924-13245946 GTCTCCAGTTAATTAATAAAGGG - Intergenic
1137905322 16:52315852-52315874 GTCTAAAGTCAATTAATTTGTGG + Intergenic
1139189484 16:64844948-64844970 GGCTCAAATCCAGTAATAGTTGG - Intergenic
1143156375 17:4839614-4839636 GTCTCAAGTCAAGGACTGGTTGG - Intronic
1143986782 17:10921497-10921519 GACTCAGGGCAATTAGTAGTAGG - Intergenic
1149467235 17:56889756-56889778 GTCTGAAACCAATTAATACTTGG - Exonic
1162866829 19:13554389-13554411 GACTCAAGTCATTTAAATGTAGG - Intronic
925011078 2:486759-486781 GTCTCAAGTCCAATGAGAGTGGG + Intergenic
929839146 2:45438493-45438515 GTCCCAAATCAATGAATAGATGG + Intronic
934574838 2:95393328-95393350 GGCAGAAGTCAATTGATAGTTGG + Intergenic
942530549 2:176905240-176905262 GTCAGAAGTCACTTAACAGTAGG + Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
947393273 2:229662007-229662029 TTTTTAAGTCAATTAATATTTGG + Intronic
1170411523 20:16097207-16097229 GTCACATGTCACTTAATATTGGG + Intergenic
1173063411 20:39683583-39683605 TTATCCAATCAATTAATAGTTGG - Intergenic
1177225449 21:18247058-18247080 GTCACAAATCAATTTATAGATGG - Intronic
952733271 3:36662413-36662435 GTGTCCAGTCATTTAATTGTGGG - Intergenic
953132166 3:40150569-40150591 GTTTCAGGGCATTTAATAGTAGG - Intronic
957916321 3:86692529-86692551 GCCTAAAGGCAAGTAATAGTAGG + Intergenic
957941197 3:87006463-87006485 GTCTAGAGTCAATAAATAGGAGG + Intergenic
958159241 3:89795589-89795611 CTCTCCAGTCACTTAATAATTGG - Intergenic
965833037 3:172817323-172817345 GTCTCTAGTTCATTCATAGTAGG - Intronic
971056948 4:22923850-22923872 GTCACATGTCATTTAATAATGGG + Intergenic
972501878 4:39685397-39685419 GTCCCTAATCAATTATTAGTCGG + Intergenic
974343711 4:60649950-60649972 GTATGAAGTCAATAAATATTAGG - Intergenic
976047404 4:80967471-80967493 GTCTCAAATCAATTGTCAGTAGG + Intergenic
976112919 4:81695997-81696019 CTGTAATGTCAATTAATAGTGGG - Intronic
976405111 4:84654386-84654408 GTCTCAAATTAATTAAAAATGGG - Intergenic
978724893 4:111958109-111958131 GTCTTAGGTCAATTCCTAGTTGG - Intergenic
979297415 4:119049740-119049762 TTCTCATGTCAATTAAATGTTGG - Intronic
980479614 4:133370637-133370659 GTCTCAAGGCATTCAAGAGTTGG + Intergenic
980624289 4:135352989-135353011 CTCTAAAGTGAATTAAAAGTAGG + Intergenic
983456444 4:167970326-167970348 ATCTCAAGGCATTTAATAATGGG + Intergenic
984146653 4:176069853-176069875 GTCTCAAAAAAATGAATAGTTGG + Intronic
989412918 5:41140874-41140896 GTCCCAAGACAATTAATTGTAGG - Intergenic
990171763 5:53059183-53059205 GTTTCAAGTCAATCCAGAGTAGG + Intronic
990767766 5:59206111-59206133 GTCTCAAGGCAATTAACCGTAGG + Intronic
991288080 5:65002895-65002917 GACTCCAGTAAAATAATAGTTGG - Intronic
993933290 5:93969714-93969736 GTCAAAAGTAAATTCATAGTAGG - Intronic
994568030 5:101478651-101478673 ATCTCACATCAACTAATAGTAGG + Intergenic
997431886 5:133846661-133846683 GTCTCCAGGCAATTAATACCTGG + Intergenic
1003311498 6:4973249-4973271 GTCTCAAATAAATAAATAATGGG + Intergenic
1005665294 6:28046730-28046752 GTCCCAAGGCAATGAATAGCTGG - Intergenic
1012884306 6:104827087-104827109 ATCTCAAGTCATTTAATTGAAGG + Intronic
1013349802 6:109295206-109295228 GTCACAAATCAATTCATAGAAGG - Intergenic
1013402383 6:109811470-109811492 GCCACAAGTCATCTAATAGTTGG + Intronic
1014591219 6:123273851-123273873 GCCTCAGGTCAATTGCTAGTTGG + Intronic
1014712674 6:124825938-124825960 GCATCAAGCTAATTAATAGTTGG + Intergenic
1016915016 6:149236691-149236713 GGCTGAAGAAAATTAATAGTTGG + Intronic
1022338150 7:29442710-29442732 TTCTCATGTCAATTTATACTGGG + Intronic
1022739020 7:33103513-33103535 GCCTCAACTCATTTAAGAGTAGG - Intronic
1025748100 7:64263621-64263643 CTCTCATGTGAATTAATAGAGGG - Intronic
1031381754 7:121094674-121094696 GTCACAAGCCTATTAATTGTTGG + Intronic
1034053896 7:148014206-148014228 GTTTAAAGTCAAATAATACTGGG - Intronic
1034076593 7:148237779-148237801 GTTTCACGTCAATTAACATTTGG - Intronic
1038601266 8:28945524-28945546 GTCTCAAGTAAGATAACAGTAGG + Intronic
1042063464 8:64846942-64846964 GTCTCAAGTTAACTAATAAAAGG - Intergenic
1044849124 8:96410617-96410639 GGCTCAAGACATTTACTAGTAGG + Intergenic
1046503180 8:115104930-115104952 GTCTCAAGTCATTTGCTAGTAGG - Intergenic
1047145213 8:122191021-122191043 GTCTAAACTCAACTAACAGTTGG - Intergenic
1048056140 8:130867579-130867601 GTGTCATGTCAAATAAGAGTGGG + Intronic
1048641582 8:136369599-136369621 GCCTCCAGTTAATTCATAGTGGG + Intergenic
1050420725 9:5462650-5462672 GCCTCAATTCAATTCAAAGTTGG - Intronic
1060935241 9:127510733-127510755 GTCTCAAATAAAATAATAATAGG - Intronic
1189114083 X:38326053-38326075 CTCCCAACTCAATTATTAGTTGG - Intronic
1190389926 X:49922058-49922080 GTCTAAACTCATATAATAGTAGG - Intergenic
1194063706 X:89236652-89236674 GTCACACATCACTTAATAGTGGG + Intergenic
1194374429 X:93114153-93114175 GTGTCAAGTTAATTCAAAGTTGG + Intergenic
1195830380 X:109051492-109051514 GCCTCAAATCAATTAAGAATGGG - Intergenic
1199195717 X:145027455-145027477 GTTTCAAGACAATTGCTAGTGGG + Intergenic
1200682458 Y:6228221-6228243 GTGTCAAGTTAATTCAAAGTTGG + Intergenic
1200717876 Y:6570758-6570780 GTCACACATCACTTAATAGTGGG + Intergenic