ID: 908431017

View in Genome Browser
Species Human (GRCh38)
Location 1:64057614-64057636
Sequence CAGGCCCACCCAAACTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908431016_908431017 -5 Left 908431016 1:64057596-64057618 CCTTTCATCTGATTGGATCAGGC 0: 1
1: 4
2: 21
3: 91
4: 205
Right 908431017 1:64057614-64057636 CAGGCCCACCCAAACTATTGAGG 0: 1
1: 0
2: 2
3: 37
4: 279
908431013_908431017 5 Left 908431013 1:64057586-64057608 CCTCTTAAGGCCTTTCATCTGAT 0: 1
1: 0
2: 7
3: 9
4: 111
Right 908431017 1:64057614-64057636 CAGGCCCACCCAAACTATTGAGG 0: 1
1: 0
2: 2
3: 37
4: 279
908431012_908431017 16 Left 908431012 1:64057575-64057597 CCTCAGAGATACCTCTTAAGGCC No data
Right 908431017 1:64057614-64057636 CAGGCCCACCCAAACTATTGAGG 0: 1
1: 0
2: 2
3: 37
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908431017 Original CRISPR CAGGCCCACCCAAACTATTG AGG Intronic
900817085 1:4856495-4856517 AAGGCTCACCCAGACTATTAAGG + Intergenic
901295906 1:8160741-8160763 GAGGCCCACCCACATTATTGAGG + Intergenic
901784155 1:11613539-11613561 GAGGCCCACCCACATTATGGCGG + Intergenic
903386215 1:22928704-22928726 GAGGCCCACCCAAATTACTGAGG + Intergenic
903662443 1:24986538-24986560 GAGGCCCACCCACATTATGGAGG - Intergenic
904460066 1:30671302-30671324 GAGGCCCACCCACATTATGGAGG - Intergenic
904864078 1:33562743-33562765 GAGGCCCACCCACATTATGGAGG - Intronic
905156058 1:35983130-35983152 CAGGCCCATCCACATTATTCAGG + Intronic
906354515 1:45092745-45092767 GAGGCCCACCCACATAATTGAGG - Intronic
906780219 1:48566665-48566687 GAGGCCCACCCACATTATGGAGG - Intronic
906861953 1:49370482-49370504 GGGGACCACCCAAATTATTGTGG + Intronic
906922297 1:50077474-50077496 GAGGCCCACCCAAATTAGGGAGG + Intronic
907549286 1:55290665-55290687 GAGGTCCACCCACATTATTGAGG + Intergenic
907889863 1:58626519-58626541 GAGGCTCACCCAAATTATGGAGG - Intergenic
908431017 1:64057614-64057636 CAGGCCCACCCAAACTATTGAGG + Intronic
908927503 1:69273950-69273972 GAGGCCCACCCACACTGGTGAGG + Intergenic
909696288 1:78471532-78471554 AAGGCCCACCCACACGATGGAGG - Intronic
910203800 1:84726884-84726906 GAGGCCCACCCACATTATGGAGG + Intergenic
910972127 1:92866689-92866711 CAGGCTCACCCAGACTATCTAGG - Intronic
911417811 1:97597624-97597646 AGGGCCCACCCACATTATTGAGG - Intronic
913519766 1:119633574-119633596 GAGGCCCACCCACATTATGGTGG + Intronic
915481641 1:156190309-156190331 GAGACCCACCCACATTATTGAGG + Intergenic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
918523600 1:185441555-185441577 CAGACCCACTCAGATTATTGAGG + Intergenic
920545565 1:206813836-206813858 GAGGCCCGCCCACCCTATTGAGG - Intronic
920669527 1:207992472-207992494 GAGGCCCACCCACATTATGGAGG - Intergenic
920942105 1:210493450-210493472 AAGGCCCACCCACATTATGGAGG + Intronic
921196240 1:212760416-212760438 CAGGCCCAGCCAACATACTGCGG + Intronic
921853878 1:219959953-219959975 GAGGCCCACCCACATTAGTGAGG - Intergenic
922026219 1:221751645-221751667 GAGGCCCACCCAAATTATGGGGG - Intergenic
922561774 1:226574903-226574925 AAGGCCCACCCCAACTCATGGGG + Intronic
922975840 1:229782669-229782691 GAGGCCCACCCACATTATGGAGG + Intergenic
923491699 1:234489852-234489874 GAGGCCCACCCACACTATGGGGG - Intergenic
923536475 1:234856056-234856078 GAGGCCCACCCACACTACAGAGG + Intergenic
1063238072 10:4139967-4139989 CAGGCCCACCCTTAATATGGTGG + Intergenic
1063356694 10:5407204-5407226 GAGGCCCACTCACATTATTGAGG - Intergenic
1063860765 10:10305481-10305503 CAGCCCCACCCAAACCCTGGGGG - Intergenic
1064129184 10:12693026-12693048 TAGGCCCACCCACATTATAGAGG - Intronic
1064380020 10:14833277-14833299 AAGGCCCACCCACATTATGGAGG - Intronic
1064793328 10:18984240-18984262 CAGGCCCACCCAGATTATATTGG - Intergenic
1066063184 10:31742429-31742451 GAGGCCCACCCACATTATAGAGG - Intergenic
1068391000 10:56396689-56396711 GAGGCCCATCCAAATTATGGAGG + Intergenic
1068801723 10:61148288-61148310 CACTCCCACCCAAAATATTGGGG + Intergenic
1070706616 10:78643708-78643730 AAGGCCCACCCACATTATGGAGG + Intergenic
1070984163 10:80673768-80673790 CAGGCCCACCCCCAACATTGGGG - Intergenic
1071169017 10:82841655-82841677 GAGGCCCTCACAAACTATTGAGG + Intronic
1072347193 10:94519838-94519860 CAGGCCCACCCAGATAATTCAGG + Intronic
1075117108 10:119636207-119636229 GAGGCACACCCATACTATGGAGG + Intergenic
1075836765 10:125460506-125460528 GAGGCCCACCCACATTATGGAGG - Intergenic
1075837738 10:125470129-125470151 CAGGCCCTCCCAAGATATGGTGG + Intergenic
1077502856 11:2917074-2917096 CTGGCCCACCCACCCCATTGGGG - Intronic
1078024347 11:7680454-7680476 CAGGCCCACCCGGATAATTGAGG - Intergenic
1078447460 11:11415208-11415230 CAGGCCCAACCAACCGATTGGGG + Intronic
1079552299 11:21715027-21715049 CAGGCCCACCTACAATATGGGGG - Intergenic
1079885511 11:25983480-25983502 GAGGCCCACCCACATTATGGAGG + Intergenic
1080208488 11:29757470-29757492 CAGGCCCACCCAGATAATTCAGG + Intergenic
1080364319 11:31553369-31553391 GAGGCCCACCCAAATTAGGGAGG - Intronic
1080722843 11:34866674-34866696 GAGGCCCACCCATATTATGGGGG + Intronic
1080798566 11:35588561-35588583 AAGGCCCACCCACATTATGGAGG - Intergenic
1082768041 11:57184062-57184084 CAGCCCTCCCCAAACTATTTTGG - Intronic
1083153202 11:60806534-60806556 CAGGCCCACCCAGATTATCTAGG + Intergenic
1086080215 11:82896359-82896381 AAGGCCCACCCAAATTATGGAGG - Intronic
1088981319 11:114866691-114866713 AAGGTTCACCCAAAATATTGAGG - Intergenic
1090819350 11:130327098-130327120 CATGCCCAGCCAATTTATTGTGG + Intergenic
1090821552 11:130347014-130347036 AAGGCCCACCCACATTATCGGGG - Intergenic
1092750297 12:11712694-11712716 GAGGCCCACCCATATTATGGAGG + Intronic
1093227469 12:16503207-16503229 CTGTCCAACCCAAACTATTGTGG - Intronic
1093253800 12:16840901-16840923 GAGGCCCACCCACATTACTGAGG - Intergenic
1097753633 12:63385233-63385255 GAGGCCCACCCACATTATGGAGG + Intergenic
1099678754 12:85796227-85796249 CAGCCCCACCCTAACTAATCTGG + Intergenic
1100569317 12:95832102-95832124 GAGGCCCACCCACATTATGGAGG - Intergenic
1101377006 12:104179821-104179843 CAGGCCCACCTATAACATTGAGG + Intergenic
1102813975 12:115847580-115847602 AAGGCCCACCCATATTATAGAGG - Intergenic
1104424198 12:128661249-128661271 CAGGCCCACCCAGATTATGCAGG + Intronic
1104502019 12:129295038-129295060 GAGGCCCACCCACATTATGGAGG - Intronic
1107273441 13:38648332-38648354 CAGGGCCACCCAAGTTATTTAGG - Intergenic
1107707417 13:43121697-43121719 AAGGCCCACCCACATTATGGCGG - Intergenic
1107857024 13:44626353-44626375 GAGGCCCACCCACATTATTGAGG - Intergenic
1108424929 13:50289990-50290012 CAGGCCCACCAAAACTGTCTAGG + Intronic
1110280009 13:73681997-73682019 GAGGCCCACCCACATTATGGGGG + Intergenic
1110781943 13:79476677-79476699 CAGACCCACCCAGATTATTGAGG - Intergenic
1112407106 13:99130804-99130826 GAGGCCCACCCAGATTATGGTGG + Intergenic
1112742455 13:102490401-102490423 CAGGCCCACCCAGATTATCTGGG + Intergenic
1113402123 13:110003977-110003999 AAGGCCCACCCACATTTTTGAGG - Intergenic
1114688359 14:24556691-24556713 CAGGCCCACCCACATTAGAGAGG + Intergenic
1115310206 14:31971811-31971833 TAGGCCCACCCAAATTATTGAGG + Intergenic
1115437803 14:33396016-33396038 CAGCCCCACCCAAAGTAGTCAGG + Intronic
1115667305 14:35565456-35565478 GAGGCCCACCCACATTATAGAGG - Intronic
1117292359 14:54345739-54345761 GAGGCCCACCCATATTATGGAGG - Intergenic
1117515610 14:56498315-56498337 CAGGCCCACCCAGATTATCTAGG + Intronic
1120378889 14:83748028-83748050 GAGGCCCACCCACACTAGAGAGG - Intergenic
1120710887 14:87792004-87792026 AAGGCCCACCCAGATTATTAAGG + Intergenic
1120902399 14:89587214-89587236 GAGGCCCACCCACATTATGGGGG + Intronic
1122567823 14:102674211-102674233 AAGGCCCACCCACATTATGGAGG + Intronic
1123708537 15:22968343-22968365 GAGGCCCACCCAAATTATGGAGG - Intronic
1124136253 15:27038663-27038685 CAGGACCAACCAAGCTCTTGGGG + Intronic
1124846578 15:33297196-33297218 CAGGCCCACCCAGATTATCCAGG + Intergenic
1126750389 15:51870970-51870992 GAGGCCCACCCACATTATGGAGG + Intronic
1128816693 15:70615138-70615160 AAGGCCCACCAACACTATGGAGG + Intergenic
1130377238 15:83340245-83340267 GAGGCCCACCCATATTATGGAGG - Intergenic
1131487482 15:92833689-92833711 GAGGCCCACCCACAGTATGGAGG + Intergenic
1131943381 15:97592329-97592351 GAAGCCCACCCAGATTATTGTGG - Intergenic
1132138641 15:99369609-99369631 GAGGCCCACCCACACTATGGAGG + Intronic
1132306247 15:100815330-100815352 GAGGCCCACTCACATTATTGAGG + Intergenic
1133066690 16:3212788-3212810 AAGGCCCACCCACATTATGGAGG + Intergenic
1135147861 16:19978742-19978764 TAGGCCTACCCAAAGTATTGGGG + Intergenic
1135886645 16:26316011-26316033 GAGGCCCACCCATATTATAGAGG - Intergenic
1137959533 16:52868376-52868398 GAGGCTCACCCAGATTATTGAGG + Intergenic
1138657030 16:58497442-58497464 CAGGCCCACCCAGAGTGCTGGGG + Intronic
1138964525 16:62068176-62068198 GAGGCCCACCCACATTATGGAGG + Intergenic
1139539777 16:67606112-67606134 CAAGACCATCCAAACTATGGGGG + Intronic
1140374049 16:74430576-74430598 GAGGCCCACCCATATTATGGAGG + Intergenic
1143353217 17:6305080-6305102 AAGGCCCACCCACATTATGGAGG + Intergenic
1144006568 17:11105860-11105882 CATGACCACCCCAACTATTAAGG + Intergenic
1144129090 17:12228674-12228696 CAGGCCCATCCAATCCATTGAGG - Intergenic
1144188974 17:12825635-12825657 GAGGCCCACCCACATTATTGAGG + Intronic
1144596045 17:16570928-16570950 CAGGCCCACCCAAATTATCTAGG - Intergenic
1146165788 17:30587336-30587358 GAGGCCCACCCACATTATGGAGG - Intergenic
1146289820 17:31599070-31599092 AAGGCCCACCCATACTGGTGAGG + Intergenic
1147996047 17:44361048-44361070 CAGGCCCAAGAGAACTATTGTGG + Intronic
1149561640 17:57611732-57611754 CAGGCCCAGCCAAACCAGTGTGG + Intronic
1149899911 17:60465716-60465738 GAGGCCCAACCAAACAATTTAGG + Intronic
1152348558 17:79769899-79769921 CAGACCCACCCAGATTATTCGGG - Intergenic
1156435540 18:37124440-37124462 CATTCCCACCCAGATTATTGTGG + Intronic
1158860145 18:61583724-61583746 AAGGCCCACCCATATGATTGAGG - Intergenic
1158982401 18:62776383-62776405 TAGGCCCACCCACATTATAGAGG + Intronic
1159849920 18:73515352-73515374 CAGGCCCACCCTTACTCTGGGGG + Intergenic
1161825088 19:6558165-6558187 GAGGCCCACCCACATTATGGAGG + Intergenic
1163662929 19:18589298-18589320 CAGGCCCACCCCTGCTCTTGGGG - Intronic
1167736678 19:51298696-51298718 CAGACCCACCTACATTATTGAGG + Intergenic
925857879 2:8148183-8148205 GAGTCCCACCCACACTATGGAGG + Intergenic
928315221 2:30239450-30239472 CAGCGCCTCCCAAACTCTTGAGG - Intronic
928410615 2:31051362-31051384 GAGGCCCACCCATATTATGGAGG - Intronic
929201115 2:39237602-39237624 CTTGGCCTCCCAAACTATTGGGG - Intergenic
930460737 2:51671581-51671603 AAGGCCCACCCATATTATGGAGG - Intergenic
930827971 2:55713496-55713518 GAGGCCAACACAAACTAGTGAGG + Intergenic
931073170 2:58678010-58678032 GAGGCCCACCCACATTATAGAGG + Intergenic
931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG + Intergenic
931687008 2:64802808-64802830 AAGGCCCACCCACACTGGTGAGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934773662 2:96923796-96923818 CAGCCCCACCCAACATCTTGAGG - Intronic
934919263 2:98329747-98329769 CAGGCCCACCCAGATTATCTAGG - Intergenic
935668892 2:105538578-105538600 GAGGCCCACCCACATTATGGAGG - Intergenic
937086040 2:119172507-119172529 CATGCCCACTCAGATTATTGAGG + Intergenic
937942242 2:127294935-127294957 GAGGCCCACCCGCATTATTGAGG - Intergenic
938244216 2:129764893-129764915 GAGGCCCACCTACACTATGGAGG - Intergenic
939713608 2:145555547-145555569 AAGGCCCACCCAAGCTAAAGGGG + Intergenic
939813814 2:146869515-146869537 GAGGCCCACCCAAATTATGGAGG - Intergenic
940413504 2:153393709-153393731 AAGGCCCACCCACATTATGGAGG - Intergenic
941589012 2:167395311-167395333 CAGGCCCACCCAGACAATCCAGG - Intergenic
941650511 2:168087464-168087486 CAGGCCCACCCAGATTATCAAGG - Intronic
944435275 2:199682177-199682199 GAGGCCCACCCACATTATGGAGG - Intergenic
944444684 2:199777507-199777529 GAGGCCCACCCAAACTATGGAGG + Intronic
946133232 2:217623689-217623711 GAGGCCCACCCACATTATGGAGG - Intronic
946140824 2:217689222-217689244 GAGGCCCACCCACATTATGGAGG - Intronic
946186568 2:217983987-217984009 GAGGCCCACCTAAATTATGGAGG - Intronic
947050691 2:226039388-226039410 CAGGCCCACCCAGATTATTTAGG + Intergenic
947281940 2:228464684-228464706 GAGGCCCACCCACAATACTGGGG + Intergenic
949024463 2:241759997-241760019 AAGGCCCACCCACACTGTGGTGG - Intronic
1169248873 20:4045281-4045303 GAGGCCCACCCACATTATGGAGG + Intergenic
1169338685 20:4779367-4779389 GAGGCCCACCCACATTATGGAGG + Intergenic
1170597084 20:17814194-17814216 GAGGCCCACCCACATTATGGAGG + Intergenic
1170684191 20:18554201-18554223 CAAACCAACCAAAACTATTGTGG - Intronic
1171353107 20:24520480-24520502 CAGGCTGACCCAAACTCTTGAGG - Intronic
1173745276 20:45431943-45431965 AAGTCCCACCCAAGCTCTTGGGG - Intergenic
1175634356 20:60568263-60568285 TAGGCCCACCCATATTATGGAGG - Intergenic
1175805121 20:61823153-61823175 GAGGCCCACTCACACTGTTGAGG + Intronic
1178027057 21:28479854-28479876 GAGGCCCACCCACATTATGGAGG - Intergenic
1178884198 21:36472552-36472574 GTGGCCCACCCACACTATGGAGG - Intronic
1179068697 21:38051913-38051935 CAGGCCCACCCACATTATCAAGG - Intronic
1179140980 21:38725019-38725041 GAGGCCCACCCACATTATAGAGG + Intergenic
1179181900 21:39052907-39052929 GAGGCCCACCCAAATTATCAAGG + Intergenic
1179617502 21:42591355-42591377 CAGGCCCACCCAAGTTATGGAGG - Intergenic
1181458400 22:23072045-23072067 CAGGCCCACCCCAGCTCATGGGG - Intronic
1183056255 22:35307988-35308010 GAGGCCCACCCATGTTATTGAGG - Intronic
1184887959 22:47357990-47358012 GAGGCCCACCCACCCTAGTGTGG - Intergenic
949242185 3:1886430-1886452 AAGGCCCACCCACATTATGGGGG + Intergenic
949564863 3:5235238-5235260 CAGCCCCACCCAGACTACAGAGG - Intergenic
949903343 3:8838078-8838100 CAGTCCCAGCCAAACCAGTGAGG + Intronic
950834110 3:15903013-15903035 CAGGCACACCAAATGTATTGAGG + Intergenic
951131658 3:19053507-19053529 CATACCCACCCAGATTATTGAGG + Intergenic
953233602 3:41086299-41086321 GAGGCCCACCCAGACTATCAAGG - Intergenic
954927506 3:54249339-54249361 AAGGCCCACCCACATTATAGAGG - Intronic
955299957 3:57768769-57768791 GAGGCCCACCCACATTATGGAGG - Intronic
956637626 3:71382116-71382138 CATGCCCAGCCAAAATATTTTGG - Intronic
956684897 3:71816991-71817013 GAGGCCCACTCACATTATTGAGG + Intergenic
956694014 3:71903449-71903471 GAGGCCCACCCACAATATGGAGG + Intergenic
957251044 3:77771574-77771596 GAGGCCCACCCACATTATGGAGG - Intergenic
957310884 3:78517113-78517135 GAGGCCCACCCACATTATGGAGG - Intergenic
957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG + Intergenic
958100610 3:89004421-89004443 CAGGCACACCTAAGATATTGTGG + Intergenic
958931714 3:100214635-100214657 GAGGCCCACCCACATTATGGAGG + Intergenic
958951460 3:100421314-100421336 CAGGTCCACCCACAGTATGGAGG + Intronic
959406132 3:105963508-105963530 GAGGCCCACCCACACTATGGAGG - Intergenic
959577650 3:107951673-107951695 GAGGCCCACCCACATTATGGAGG + Intergenic
961219573 3:125189131-125189153 GAGGCCCACCCATACTATGGAGG - Intronic
962274794 3:134003848-134003870 CTGGCCCACCCAAATTATCTAGG - Intronic
963585690 3:147185288-147185310 AAGACCCACCCACATTATTGAGG - Intergenic
969192324 4:5532305-5532327 GAGGCCCACCCACATTATGGAGG + Intergenic
969961508 4:10948999-10949021 TAGGCCCACCTAAATTATTGAGG - Intergenic
970876889 4:20881826-20881848 GAGGCCCACCCACATTATTCAGG - Intronic
970941875 4:21643630-21643652 CAGGCCCATCCACACAATTGAGG - Intronic
971266552 4:25100913-25100935 GAGGCCCACCCACATTATGGAGG + Intergenic
973193955 4:47418457-47418479 GAGGCCCACCCACATTATCGAGG + Intronic
973198770 4:47476497-47476519 GAGGCCCACCCACATTATAGAGG - Intergenic
974130672 4:57751736-57751758 GAGGCCCACCCACATTATAGAGG + Intergenic
974183003 4:58407319-58407341 AAGGCCCACCCAAATTATCAAGG - Intergenic
975054236 4:69908074-69908096 CAGGACCACACAAGCTGTTGAGG - Intergenic
976395304 4:84549365-84549387 GAGGCCCACCCACATTATGGAGG - Intergenic
978255024 4:106682624-106682646 GAGGCCCACCCACAATATGGAGG - Intergenic
979048448 4:115899110-115899132 GAGGCCCGCCCAAATTATGGAGG - Intergenic
979140397 4:117165117-117165139 GAGGCCCACCCACATTATGGAGG + Intergenic
979217638 4:118184352-118184374 GAGGCCCACCCACATTATGGAGG - Intronic
979449380 4:120852388-120852410 GAGGCCCACCCACATTATGGAGG - Intronic
980072277 4:128256235-128256257 CAGGCCCATCCACATTATGGAGG + Intergenic
981110654 4:140929807-140929829 AAGGCCCACCCAGATTGTTGAGG - Intronic
981574937 4:146194411-146194433 GAGGCCCACCCACATTATGGGGG + Intronic
982256115 4:153453197-153453219 CAGGCCCATCCAAACTCATAGGG + Intergenic
982634095 4:157870338-157870360 CAAGCCCACCCAAATAATTTGGG + Intergenic
982726377 4:158910643-158910665 GAGGCCCACCCACATTATGGAGG - Intronic
984151658 4:176141001-176141023 TAGGCCCACCAACACTTTTGAGG - Intronic
984413878 4:179432595-179432617 GAGGCCCACCCACATTATGGAGG + Intergenic
985093675 4:186390494-186390516 TAGGCCCACCTACATTATTGAGG + Intergenic
986172127 5:5323738-5323760 GAGGCCCACCCATACTATGGAGG - Intergenic
986270556 5:6227150-6227172 GAGGCCCACCCACATTATGGAGG + Intergenic
986724160 5:10581718-10581740 GAGGTCCACCCAAATTATAGAGG - Intronic
987951604 5:24683940-24683962 CAGGCCCACTCACATTATGGTGG - Intergenic
988213777 5:28244813-28244835 CAGGCCCACTCAGATTATTGGGG - Intergenic
988592883 5:32564289-32564311 GAGGCCCACTCACACTATGGAGG - Intronic
991405536 5:66297726-66297748 GAGGCCCACCCACATTATGGAGG + Intergenic
994296689 5:98098121-98098143 GAGGCCCACCCACACTATGGAGG + Intergenic
994380624 5:99066747-99066769 GAGGCCCACCCACATTATGGAGG - Intergenic
994526308 5:100909227-100909249 TAGGCCCACCCACATTATGGCGG + Intergenic
994812749 5:104543093-104543115 CAGGCCCACAAAAATTATTTAGG + Intergenic
995773399 5:115697919-115697941 GAGGCCCACCCACATTATGGAGG - Intergenic
996137961 5:119868587-119868609 CAGGCACAACTAAACTGTTGTGG - Intergenic
998425719 5:142026976-142026998 CGGGCCCACCCAGATTATTTTGG + Intergenic
1000337259 5:160251132-160251154 GAGGCCCACCCACATTATGGAGG - Intergenic
1001327860 5:170742506-170742528 GAGGCCCACCCACATTATGGAGG - Intergenic
1001905907 5:175472977-175472999 GAGGTCCACCCACATTATTGAGG - Intergenic
1002398376 5:178975848-178975870 GAGGCCCACCCAGATGATTGGGG - Intergenic
1003721746 6:8710867-8710889 CAGGCCCACCCACATTAAGGAGG + Intergenic
1003761663 6:9185359-9185381 CAGGCCCACCCAGATTATTAAGG + Intergenic
1004321488 6:14634888-14634910 GAGGCCCACCCACATTATTCAGG - Intergenic
1006760424 6:36455831-36455853 CAGGCCCACCCAGATTATCTAGG + Intronic
1006771033 6:36553170-36553192 GAGGCCCACCCACATTATGGCGG + Intergenic
1007148179 6:39658957-39658979 TAGGCCCACCCAAACTATCCTGG + Intronic
1009750720 6:67876057-67876079 AAGGCCCACCCACATTATGGAGG + Intergenic
1010529252 6:76946387-76946409 CAGTCCTACTCAAACTATTCTGG + Intergenic
1011614603 6:89186343-89186365 CAGGCCCACCCAGATTATCCAGG - Intronic
1012934418 6:105351215-105351237 CAGGCCCACTCAAATTATCCAGG - Intronic
1014451662 6:121588562-121588584 GAGGCCCACCCACATTATAGGGG - Intergenic
1016163411 6:140908639-140908661 CAGGGCAACCCACACTCTTGGGG - Intergenic
1016651968 6:146472379-146472401 CAGGCCCACCCAGATTATCTAGG - Intergenic
1016795830 6:148116194-148116216 GAGGCCCACCCACACTGATGAGG + Intergenic
1017966280 6:159269843-159269865 AAGGCCCACCCACAATATGGAGG + Intronic
1018198199 6:161373176-161373198 GAGGCCCACCCACATTATAGAGG + Intronic
1018858846 6:167696223-167696245 CAGGCCCACTGAGACTAATGGGG - Intergenic
1019513347 7:1429260-1429282 CAGGCCCACCCTCACCTTTGTGG - Intronic
1021931925 7:25589662-25589684 CAGGACTACCCAAACTCTTTAGG - Intergenic
1022484148 7:30765131-30765153 GAGGCCCACCCACACTATGAAGG + Intronic
1022507117 7:30914180-30914202 CACGCCCAGCCCAAGTATTGGGG - Intronic
1025953919 7:66167953-66167975 CTCGGCCACCCAAAGTATTGGGG + Intergenic
1027428826 7:78088888-78088910 TAGGCCCACCCAAACAATCCTGG - Intronic
1028453439 7:91012303-91012325 AAGGACTACCCAAAATATTGAGG - Intronic
1028508470 7:91595863-91595885 GAGGCCCACCCACATTATGGAGG + Intergenic
1028811967 7:95098062-95098084 GAGGCCCACCCAGATTATTTAGG + Intronic
1029578833 7:101421328-101421350 AAGGCCCACCCACATTATAGAGG + Intronic
1031063791 7:117082098-117082120 CAGGCCCACCCAGATTATCTAGG + Intronic
1032517079 7:132514573-132514595 GAGGCCCACCCACATTATAGAGG - Intronic
1032538111 7:132681411-132681433 GAGGCCCACCCACATTATGGAGG + Intronic
1032580245 7:133097312-133097334 AAGGCCCACCCACATTATTGAGG + Intergenic
1035367300 7:158357555-158357577 CAGGCCCACCCAAATCACTGAGG + Intronic
1036957192 8:13200847-13200869 CTTGGCCCCCCAAACTATTGGGG + Intronic
1038242752 8:25825012-25825034 GAGGCCCACCCAGATTATTAAGG + Intergenic
1039253242 8:35689745-35689767 GAGGCCCACCCACATTATGGAGG + Intronic
1040653232 8:49473908-49473930 GAGGCCCATCCACACTATTGAGG + Intergenic
1040799804 8:51328055-51328077 GAGGCCCACCCACATTATGGAGG - Intronic
1041020798 8:53636231-53636253 AAGGCCCATCCACACTATGGAGG + Intergenic
1046112064 8:109737533-109737555 CAGGCCCATCCCAACAATGGTGG - Intergenic
1046675712 8:117105697-117105719 GAGGCCCACCCACATTATTGAGG + Intronic
1048237437 8:132705047-132705069 GAGGCCCACCCACATTATGGAGG + Intronic
1048317495 8:133373117-133373139 CAGGGCCACCCAGACAAATGGGG - Intergenic
1048487758 8:134864641-134864663 GAGGCCCACCCAAATTATAAAGG + Intergenic
1049937387 9:512456-512478 GAGGCCCACCCACATTATGGAGG + Intronic
1051027106 9:12626012-12626034 CAGGCCCACCTACATTATGGAGG - Intergenic
1051897045 9:21997688-21997710 GAGGACCACCCATATTATTGAGG + Intronic
1052670947 9:31556474-31556496 GAGGCCCACCTACATTATTGAGG + Intergenic
1052841788 9:33297864-33297886 CAGGCCCACCCATACTCAAGGGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053861526 9:42391002-42391024 AAGGCCCATCCACACTATGGAGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1056217995 9:84423147-84423169 GAGGCCCACCCACATCATTGAGG + Intergenic
1056694278 9:88833117-88833139 CAGGTCCACACAAACCATTCAGG + Intergenic
1061016345 9:127982981-127983003 CAGGCCCAGCCAAGATAGTGAGG - Intergenic
1185751324 X:2611765-2611787 CAGGCCCTCCCAAATTCTGGAGG + Intergenic
1186764189 X:12754368-12754390 GAGGCCCACCCATATTATGGAGG + Intergenic
1187122619 X:16423810-16423832 ACGGCCCACCCAAATTATGGAGG + Intergenic
1188382252 X:29509292-29509314 CAGGCCCACCCAGATTATCCAGG + Intronic
1188447087 X:30265832-30265854 GAAGCACACCCAAACTATGGAGG - Intergenic
1188527835 X:31105501-31105523 GAGGCCCACCCACTCTATGGAGG - Intronic
1191006680 X:55717558-55717580 CAGGCCCACCCACATTAGAGAGG + Intergenic
1191102596 X:56748098-56748120 CAGGTCTACCCAAATTATTTAGG + Intergenic
1191587783 X:62847875-62847897 GAGGCCCACCCACATTATGGAGG - Intergenic
1192824310 X:74679067-74679089 GAGGCCCAGCCACATTATTGAGG - Intergenic
1195300668 X:103526963-103526985 GAGGCCCACCCACATTATAGAGG - Intergenic
1196284656 X:113864829-113864851 GAGGCCCACCCACATTATTGAGG - Intergenic
1198502231 X:137262148-137262170 GAGGCCCACCCAGATTATAGAGG - Intergenic
1198748458 X:139914600-139914622 GAGGCCCACCCACATTATGGAGG - Intronic
1199610443 X:149607884-149607906 GAGGCCCACCCATGCTATGGAGG - Intronic
1199657215 X:150008002-150008024 GAGGCCCACCCACATTATGGAGG - Intergenic
1199963323 X:152796958-152796980 CAGGCCCAACTCAACTGTTGCGG + Intergenic
1200865626 Y:8040434-8040456 CACGCTCACCAAAATTATTGTGG + Intergenic