ID: 908433429

View in Genome Browser
Species Human (GRCh38)
Location 1:64081186-64081208
Sequence TTTCAGGCTGAGCAGTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908433422_908433429 12 Left 908433422 1:64081151-64081173 CCAAGGCTGAGATTTCCCTTCTC 0: 1
1: 0
2: 2
3: 22
4: 269
Right 908433429 1:64081186-64081208 TTTCAGGCTGAGCAGTCATAGGG 0: 1
1: 0
2: 1
3: 15
4: 115
908433421_908433429 13 Left 908433421 1:64081150-64081172 CCCAAGGCTGAGATTTCCCTTCT 0: 1
1: 0
2: 2
3: 16
4: 316
Right 908433429 1:64081186-64081208 TTTCAGGCTGAGCAGTCATAGGG 0: 1
1: 0
2: 1
3: 15
4: 115
908433420_908433429 26 Left 908433420 1:64081137-64081159 CCAACAGAAATAGCCCAAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 158
Right 908433429 1:64081186-64081208 TTTCAGGCTGAGCAGTCATAGGG 0: 1
1: 0
2: 1
3: 15
4: 115
908433424_908433429 -4 Left 908433424 1:64081167-64081189 CCTTCTCATCCCTTATGTTTTTC 0: 1
1: 0
2: 1
3: 55
4: 483
Right 908433429 1:64081186-64081208 TTTCAGGCTGAGCAGTCATAGGG 0: 1
1: 0
2: 1
3: 15
4: 115
908433423_908433429 -3 Left 908433423 1:64081166-64081188 CCCTTCTCATCCCTTATGTTTTT No data
Right 908433429 1:64081186-64081208 TTTCAGGCTGAGCAGTCATAGGG 0: 1
1: 0
2: 1
3: 15
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908433429 Original CRISPR TTTCAGGCTGAGCAGTCATA GGG Intronic