ID: 908435793

View in Genome Browser
Species Human (GRCh38)
Location 1:64104614-64104636
Sequence CAGGGCCTATTGAAGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6970
Summary {0: 1, 1: 9, 2: 161, 3: 1795, 4: 5004}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908435793_908435807 18 Left 908435793 1:64104614-64104636 CCCCCACCCTTCAATAGGCCCTG 0: 1
1: 9
2: 161
3: 1795
4: 5004
Right 908435807 1:64104655-64104677 CCTGTGTCCATGTGTTATCATGG 0: 1
1: 71
2: 85
3: 73
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908435793 Original CRISPR CAGGGCCTATTGAAGGGTGG GGG (reversed) Intronic
Too many off-targets to display for this crispr