ID: 908436337

View in Genome Browser
Species Human (GRCh38)
Location 1:64110517-64110539
Sequence AAGCAGAAGAAAGATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908436337_908436342 8 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436342 1:64110548-64110570 CCTAAAAAACAGGATAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 305
908436337_908436344 12 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436344 1:64110552-64110574 AAAAACAGGATAACAAAGGAGGG 0: 1
1: 0
2: 4
3: 74
4: 917
908436337_908436343 11 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436343 1:64110551-64110573 AAAAAACAGGATAACAAAGGAGG 0: 1
1: 0
2: 4
3: 83
4: 859
908436337_908436339 -2 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436339 1:64110538-64110560 TTGCTTCCTGCCTAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908436337 Original CRISPR AAGCAGAAGAAAGATGAGGA TGG (reversed) Intronic
No off target data available for this crispr