ID: 908436339

View in Genome Browser
Species Human (GRCh38)
Location 1:64110538-64110560
Sequence TTGCTTCCTGCCTAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908436335_908436339 9 Left 908436335 1:64110506-64110528 CCATCTAATTCCCATCCTCATCT 0: 1
1: 0
2: 2
3: 37
4: 384
Right 908436339 1:64110538-64110560 TTGCTTCCTGCCTAAAAAACAGG No data
908436338_908436339 -6 Left 908436338 1:64110521-64110543 CCTCATCTTTCTTCTGCTTGCTT 0: 1
1: 1
2: 2
3: 99
4: 1074
Right 908436339 1:64110538-64110560 TTGCTTCCTGCCTAAAAAACAGG No data
908436336_908436339 -1 Left 908436336 1:64110516-64110538 CCCATCCTCATCTTTCTTCTGCT 0: 1
1: 0
2: 3
3: 58
4: 758
Right 908436339 1:64110538-64110560 TTGCTTCCTGCCTAAAAAACAGG No data
908436337_908436339 -2 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436339 1:64110538-64110560 TTGCTTCCTGCCTAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908436339 Original CRISPR TTGCTTCCTGCCTAAAAAAC AGG Intronic
No off target data available for this crispr