ID: 908436342

View in Genome Browser
Species Human (GRCh38)
Location 1:64110548-64110570
Sequence CCTAAAAAACAGGATAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 305}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908436337_908436342 8 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436342 1:64110548-64110570 CCTAAAAAACAGGATAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 305
908436338_908436342 4 Left 908436338 1:64110521-64110543 CCTCATCTTTCTTCTGCTTGCTT 0: 1
1: 1
2: 2
3: 99
4: 1074
Right 908436342 1:64110548-64110570 CCTAAAAAACAGGATAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 305
908436336_908436342 9 Left 908436336 1:64110516-64110538 CCCATCCTCATCTTTCTTCTGCT 0: 1
1: 0
2: 3
3: 58
4: 758
Right 908436342 1:64110548-64110570 CCTAAAAAACAGGATAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 305
908436335_908436342 19 Left 908436335 1:64110506-64110528 CCATCTAATTCCCATCCTCATCT 0: 1
1: 0
2: 2
3: 37
4: 384
Right 908436342 1:64110548-64110570 CCTAAAAAACAGGATAACAAAGG 0: 1
1: 0
2: 1
3: 33
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908436342 Original CRISPR CCTAAAAAACAGGATAACAA AGG Intronic
901574521 1:10190114-10190136 CCTAAAAAACACGAGAGAAAGGG - Intergenic
902883286 1:19386977-19386999 CCTAACAAACATAATAAAAATGG + Intronic
903152157 1:21417717-21417739 CCTAAAAACCGGGATAAGTAAGG + Intergenic
905946166 1:41902999-41903021 CATAAAAAACTGGATAACTTGGG + Intronic
907741988 1:57175651-57175673 GCTATAAAATAGCATAACAATGG + Intronic
908048322 1:60197439-60197461 TTTAAAAAACAGGATATCCAAGG - Intergenic
908436342 1:64110548-64110570 CCTAAAAAACAGGATAACAAAGG + Intronic
909521353 1:76572113-76572135 CCAAAAAAAGAGGAAAAAAAAGG - Intronic
910331562 1:86078273-86078295 CCTCAAAAACTGGATATAAACGG + Intronic
910342711 1:86206273-86206295 CCTTAATAATAGTATAACAACGG + Intergenic
913606682 1:120473462-120473484 CCTAAAAACCAGGATACATAAGG - Intergenic
913988655 1:143588220-143588242 CCTAAAAGCCAGGATAAGTAAGG + Intergenic
914209752 1:145566679-145566701 CCTAAAAACCAGGATACGTAAGG + Intergenic
914368422 1:147001816-147001838 CCTAAAAACCAGGATACGTAAGG - Intergenic
914584515 1:149048379-149048401 CCTAAAAACCAGGATACGTAAGG + Intergenic
915966395 1:160312446-160312468 TTTAAAAAACAGAATCACAAAGG - Intronic
916570721 1:166024817-166024839 GCTAAAATACATGACAACAATGG - Intergenic
916786099 1:168088195-168088217 CCTAAAAAGCAGGGAAATAAAGG + Intronic
917527993 1:175806419-175806441 GCTAAAATACACAATAACAATGG - Intergenic
919200599 1:194350228-194350250 TCTAGAAAACAGGATAAAATTGG + Intergenic
919525797 1:198648773-198648795 CCTGAAAAGGAGGCTAACAAAGG + Intronic
919532298 1:198738322-198738344 CTCAAAAAACAGGGTAACGAAGG - Intronic
919643511 1:200068062-200068084 CCTCATAAAAAGGACAACAAAGG - Intronic
920523536 1:206647976-206647998 CTTAAGAAACAGGATAAAACTGG + Exonic
920672201 1:208012893-208012915 CCTAAAAAACAGAGTAACTATGG - Intergenic
920946938 1:210538458-210538480 CCTTAAATAGAGGATAAGAAGGG + Intronic
922496965 1:226064482-226064504 ATTAAAAAACAGGAAAAAAATGG + Intronic
922639512 1:227214032-227214054 CCCACAAAAGAGGAAAACAAAGG + Intronic
923182114 1:231529494-231529516 CCTAAAAGTCTGGATTACAAAGG + Intronic
923476309 1:234334725-234334747 CATAAAAAGCAAGATAGCAATGG + Intergenic
923549101 1:234947456-234947478 CATAAAAACCAGCATAACAATGG + Intergenic
923707254 1:236354066-236354088 CTTATAAAACAGGATTACAAAGG - Intronic
923932101 1:238712876-238712898 ACTACAATGCAGGATAACAAAGG - Intergenic
924228759 1:241945477-241945499 CCAAAGAAACAGGCTGACAATGG - Intergenic
1062774052 10:130712-130734 CCTGAAAAACAGGGAAACCAAGG + Intergenic
1063840159 10:10062610-10062632 CCAAAAAAAAAGGATAATAAGGG + Intergenic
1064308680 10:14191401-14191423 CCTAAGAGAAAGGATATCAAGGG + Intronic
1065127248 10:22585373-22585395 CCTAAATAAAAGGATAAGAAAGG + Intronic
1065791798 10:29267237-29267259 CCTAAAAAACAGGAGAAGCAGGG + Intergenic
1066376561 10:34862689-34862711 ACTTAAAAACAGGGTTACAATGG - Intergenic
1066609009 10:37215618-37215640 CCTGAAAAACAGAAAAAAAATGG - Intronic
1067531132 10:47074427-47074449 CCAAAAATACAGGATGGCAAAGG - Intergenic
1067964286 10:50891365-50891387 TCTAAAAACCATGGTAACAATGG + Intergenic
1068071720 10:52204814-52204836 CCTTAAGAACAGGATAACAGTGG + Intronic
1068741154 10:60472934-60472956 CCTGAAACACCTGATAACAAGGG + Intronic
1069941106 10:71955887-71955909 CGTAAGAACCAGGGTAACAATGG + Intergenic
1070273255 10:74978935-74978957 CCTAAGAAACAATATAGCAAAGG - Intronic
1071216891 10:83415606-83415628 GCTAAAAAACTGCATAGCAAAGG - Intergenic
1072194515 10:93105404-93105426 CGTAAAAAACAAGATAACGTAGG + Intergenic
1072694317 10:97591607-97591629 CATAAAAAACAAGAAAAAAAGGG - Intronic
1077756062 11:5028946-5028968 CCAAATAAACATAATAACAAAGG + Intergenic
1078313546 11:10271136-10271158 TCAAAAAGACAGAATAACAAGGG + Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1080057104 11:27917604-27917626 CCTAAAGAACATGGTGACAAAGG + Intergenic
1080083398 11:28249216-28249238 TCTAAAAATGAGGATAACAGTGG + Intronic
1080488803 11:32739856-32739878 CCTCAAAAACTGGATATAAAAGG - Intronic
1081027673 11:38035840-38035862 CCCAAAGAACTGAATAACAAGGG + Intergenic
1081113557 11:39168918-39168940 GCTAAAAATCAGGACAGCAAAGG - Intergenic
1081282720 11:41230216-41230238 CCCATAAAACAGGTTCACAATGG - Intronic
1081468064 11:43343319-43343341 CCTAAATAACAAGTTAATAACGG - Intronic
1083071256 11:59984742-59984764 CCTGAAAAAGAGGCTAACATGGG + Intergenic
1086009668 11:82085482-82085504 CATACTAAACAGGAAAACAATGG + Intergenic
1087191957 11:95264290-95264312 AAGAAAAAACAGGATAACAATGG - Intergenic
1087391517 11:97541026-97541048 CCAAAAAAACTAGATATCAATGG + Intergenic
1089064845 11:115654797-115654819 GCTGAAAAAGAGGAAAACAAAGG + Intergenic
1090301720 11:125647516-125647538 CCTAAAAGACAGAAAAACAAGGG - Intronic
1093378817 12:18464950-18464972 CCTTTAAAATAAGATAACAAAGG - Intronic
1093737495 12:22638228-22638250 CCTTAAAGACAGGTTAAAAAGGG - Intronic
1095393597 12:41738539-41738561 TCTATAAAACAGTAAAACAATGG + Intergenic
1096400549 12:51302587-51302609 CCAAGAAAATAGGAAAACAAAGG - Intronic
1096890448 12:54765233-54765255 CAAAAAAAATAGGATAAGAAAGG - Intergenic
1098159866 12:67639593-67639615 CTTTAAAAAGAGGATAACAAAGG + Intergenic
1099153916 12:79150933-79150955 CCTAGAAAAAAGGAAAATAAAGG + Intronic
1099348438 12:81533385-81533407 CCTAAAGAATAGGATAAGAAAGG - Intronic
1100219027 12:92483924-92483946 CATAAAAAACACAATTACAATGG + Intergenic
1100796559 12:98187852-98187874 CCCAACAAACAGGAAAACAGTGG - Intergenic
1100957765 12:99928150-99928172 CCTAAGAAACAGGAAAAAAATGG + Intronic
1101120922 12:101579320-101579342 TCTTAAAATGAGGATAACAATGG + Intronic
1101211561 12:102539967-102539989 ACTGAAAAACAGGATGACACGGG - Intergenic
1101991382 12:109488300-109488322 CCTAGAAAACAAGATGACCAGGG - Intronic
1102414867 12:112752081-112752103 CCTAAATAACATGAAAAGAAAGG - Intronic
1103293047 12:119862898-119862920 CCTAAAAAAGAGGCTGACATTGG + Intronic
1109948949 13:69476259-69476281 CCTCAAAGACAGTATAGCAAAGG + Intergenic
1111174069 13:84570155-84570177 CTTAAAAGACAAGATAATAAAGG + Intergenic
1111901893 13:94209616-94209638 CTTAAAAAAAGGGAAAACAATGG - Intronic
1112122008 13:96423350-96423372 ACTAAAAAACAAGATCACCAAGG - Intronic
1114371853 14:22098165-22098187 GCTAAACTACAGGATATCAATGG - Intergenic
1114968383 14:27994580-27994602 TCCAAAAAACAAGATAATAAAGG - Intergenic
1116647940 14:47553309-47553331 TCTAAAAAACATTATAACTATGG + Intronic
1117683906 14:58233370-58233392 CCTAAAAAACAGCATATGAGTGG - Intronic
1118448592 14:65875595-65875617 TCTAAAAGACAGCATACCAATGG + Intergenic
1120344468 14:83267826-83267848 CCTATTAAAGAGGATAACATAGG + Intergenic
1120785449 14:88530348-88530370 CCTATAAAACAGTAACACAATGG + Intronic
1121129039 14:91428588-91428610 CCTCAAAAACAGGATTAAAGAGG + Intergenic
1122932093 14:104938367-104938389 CCTAAAAAACAGGAGAAGGCAGG - Exonic
1125877327 15:43161381-43161403 CTATAAAAACAGGATAACTAAGG + Intronic
1127060871 15:55182606-55182628 CCTAAAAACTTAGATAACAATGG + Intronic
1127892702 15:63269335-63269357 CCTGAAAAGCAGGATAGCAGTGG - Intergenic
1129049037 15:72762679-72762701 CCTAAAAAACAGGACTAAACTGG + Intronic
1132805253 16:1772246-1772268 CCTGCAAAACAGGAAGACAAAGG - Exonic
1136516457 16:30771640-30771662 CCCAAAAAACAGCATCACACGGG + Intronic
1136646395 16:31621671-31621693 CTTACACAGCAGGATAACAATGG + Intergenic
1140615337 16:76656197-76656219 GCTGAAAAACAGGATGAAAAAGG - Intergenic
1140789571 16:78378129-78378151 CCTAAAAAAAAGGAAATCCAGGG + Intronic
1142424055 16:89991464-89991486 CCTTAAAAACAGAATAATCAGGG - Intergenic
1143331024 17:6135874-6135896 TCTGCAAAACAGGATAATAATGG - Intergenic
1146549924 17:33771468-33771490 CTTAAAAAACAGCAATACAAAGG - Intronic
1146832008 17:36077684-36077706 CTTAAAAAAGAGGTTAACCAAGG + Intergenic
1149065117 17:52470205-52470227 TTTAAATAACAGGATACCAAGGG - Intergenic
1150253938 17:63729030-63729052 AATAAAAAGCAGGATAACCATGG - Intronic
1152449419 17:80367598-80367620 CGTTAAACACAGGATCACAAAGG + Intronic
1153756091 18:8284777-8284799 ACAATAACACAGGATAACAAGGG + Intronic
1153858205 18:9172329-9172351 CCTGAAAGACAGGAGAAGAATGG - Intronic
1154461814 18:14597593-14597615 TGTAAAATACAGGATATCAAGGG + Intergenic
1155692559 18:28643867-28643889 CCTAGAAAACAGCAGACCAAGGG + Intergenic
1156028156 18:32680856-32680878 TGTATAAAACAAGATAACAAGGG - Intronic
1156132562 18:33994723-33994745 CTTAACACACAGGAAAACAAAGG + Intronic
1156699864 18:39813177-39813199 TCTTAAAGACAGCATAACAATGG + Intergenic
1156928873 18:42617086-42617108 CCCCAAAAACAGGACAATAAAGG - Intergenic
1158309654 18:56144594-56144616 CCTAGAAGACAGGAGAAGAATGG - Intergenic
1158333498 18:56389273-56389295 ACTAAAAAAAAGGAAAACAAGGG + Intergenic
1159967337 18:74608248-74608270 CCAGAAAAAAAGGATATCAATGG - Intronic
1163962751 19:20712605-20712627 CGGAAGAACCAGGATAACAATGG - Intronic
1166291347 19:41865646-41865668 CTTAAAAAGCAAGATAACAGAGG + Intronic
1167197828 19:48042869-48042891 CCAAAAAAAGAGAATAAAAAAGG - Intronic
1167573257 19:50304114-50304136 CATGCAAAATAGGATAACAATGG - Intronic
1202708567 1_KI270714v1_random:3203-3225 CCTAAAAACCAGGATACGTAAGG - Intergenic
925502815 2:4525245-4525267 TCTAAGAAACAAGAAAACAAAGG + Intergenic
925584701 2:5453128-5453150 GCTAAAAAACAGTATAAATAAGG - Intergenic
925886122 2:8394815-8394837 CCTAAAAGACAAAATGACAAGGG - Intergenic
926991361 2:18684055-18684077 CCTAAAAAATTAAATAACAAAGG + Intergenic
927423461 2:22956237-22956259 CCTAGAAAACAGGAACACAGTGG + Intergenic
928735749 2:34286715-34286737 AGTAAATAACAGGAAAACAATGG - Intergenic
930925274 2:56810538-56810560 TCTCAAAACCAGGATAATAACGG - Intergenic
931417560 2:62095691-62095713 CCTAAATAACAAGATAATAATGG + Intronic
931665705 2:64608564-64608586 CTTAAAAAAAAGGAAAAAAAGGG + Intergenic
931681669 2:64754294-64754316 CCTAAAAAAGAGGATGAAGATGG + Intergenic
931819744 2:65939446-65939468 GGTAAAAAACAGTAAAACAAAGG + Intergenic
931934247 2:67178289-67178311 CCTAGGAAACAGGAGATCAAAGG - Intergenic
934569964 2:95363532-95363554 CCTAAAAAGAAAAATAACAAGGG - Intronic
934906639 2:98210732-98210754 CCCAAGAATCAGGATAAGAAGGG - Intronic
935059128 2:99592941-99592963 CCCAAAAAAAGGGATAATAATGG + Intronic
935287336 2:101576820-101576842 CCAAAAACACAGGATAAAATAGG + Intergenic
935927317 2:108083625-108083647 CCCAAAAAGGAGGATAAGAATGG + Intergenic
936241147 2:110789850-110789872 CCTAAACAACAGCCCAACAAGGG - Intronic
939043791 2:137224896-137224918 CCAAATAAACATGATTACAAAGG - Intronic
940398982 2:153224526-153224548 AATTAAAAACAGGAAAACAATGG + Intergenic
940697912 2:157003056-157003078 CATGAAAAAGAAGATAACAATGG + Intergenic
942500405 2:176583825-176583847 CATAAAAAACAGGCCACCAAGGG + Intergenic
942684844 2:178520336-178520358 CCTAAAATATGGGATAAGAAGGG - Intergenic
942752827 2:179307284-179307306 CTTAAAACACAGAATATCAAGGG - Intergenic
943643247 2:190381868-190381890 TCTAAGAAACAGGAAAACTAAGG + Intergenic
944821581 2:203437900-203437922 CCTAAACAAGAGAATAAAAATGG - Exonic
945599451 2:211840610-211840632 CCTCAAAAACAGCACAAGAATGG + Intronic
946144708 2:217721060-217721082 TCTAAAAAACAGCAAAAGAAAGG + Intronic
946480180 2:220048332-220048354 TCCAAGAAACAGGAAAACAAGGG + Intergenic
947175435 2:227362205-227362227 TTTAAAAAACAGGATAACAAGGG - Exonic
947489687 2:230582857-230582879 CCCAAAAAACACAACAACAAAGG + Intergenic
1169671129 20:8104005-8104027 AGTAAAAAACAGGATAAAGAAGG - Intergenic
1170619482 20:17982545-17982567 CCTAAAGTATAGGATAGCAATGG - Intronic
1171491253 20:25519282-25519304 TATAAAATACATGATAACAAAGG - Intronic
1173257071 20:41401384-41401406 CATAAAACACAGGATCACCAGGG - Intergenic
1173414923 20:42846827-42846849 CCTAAGACACAGGAAAACAAAGG - Intronic
1174379680 20:50148579-50148601 CCTGGAAAGCAGGATGACAAAGG - Intronic
1175143430 20:56877966-56877988 TCTAATAAATAGGATAACCATGG + Intergenic
1176812740 21:13560997-13561019 TGTAAAATACAGGATATCAAGGG - Intergenic
1177546382 21:22563442-22563464 CCTAAAAAGAAAGATAAGAAAGG + Intergenic
1177966313 21:27731442-27731464 CATAAATAACAAGATAAAAAAGG - Intergenic
1178399968 21:32277381-32277403 CCTTAAAAACATGTAAACAAGGG + Intronic
1179000099 21:37449770-37449792 CCTCAAAAACAGGATATTTATGG - Intronic
1179887669 21:44321337-44321359 ACTAGAAAACAGGATAGCCAGGG + Intronic
1180207480 21:46270236-46270258 CCTATAAAACAGGGCAACACCGG + Intronic
1182846192 22:33433130-33433152 CCTAGGAAACAGGCTCACAAAGG + Intronic
1184104053 22:42357275-42357297 CCTAGAGCACAGGATAAAAAGGG - Intergenic
1184546474 22:45172606-45172628 CCAAAAAAAAAGGATAGGAAAGG + Intronic
1184625805 22:45728161-45728183 CCTATAAAACAGTAACACAATGG - Intronic
949691630 3:6646702-6646724 CCTAAAAAACAGGAAAGAAAAGG + Intergenic
949782357 3:7704083-7704105 CATATAAAACATGATAACATTGG + Intronic
949829073 3:8195467-8195489 CCTAGAAAACAGACTAAAAAGGG - Intergenic
950276052 3:11661835-11661857 AATAAGAAACAGGACAACAAGGG + Intronic
950290728 3:11782216-11782238 CCAAGAAAACAGGATTACAGAGG - Intergenic
950737864 3:15025206-15025228 CCTTAAAAACAGATTACCAAGGG + Intronic
951490295 3:23262737-23262759 ACTAAAAACCTGCATAACAAAGG - Intronic
951794201 3:26519683-26519705 CCTAAAAAACTGGATATAGAAGG - Intergenic
952049234 3:29362850-29362872 ACTAAAGAACAGGAATACAATGG - Intronic
953401492 3:42624431-42624453 CCTAAAAAATAAGAATACAAAGG - Intronic
955064130 3:55520054-55520076 CCAAAAAAAAAGGAAAAAAAAGG + Intronic
956088156 3:65635613-65635635 CCTAAAACCCTGGATTACAAGGG - Intronic
956593830 3:70945305-70945327 CCTAAAAAGCAGTATTACCAGGG - Intergenic
959745523 3:109772156-109772178 CATAAAAAACAGTAAAATAATGG + Intergenic
959937798 3:112047695-112047717 CCTAAAAAAAAAGAAAATAAAGG + Intronic
960020770 3:112949778-112949800 CCATAAAATCAGGATTACAAAGG + Intronic
961616125 3:128182647-128182669 CATAAAAGACAGAATAACCAAGG - Intronic
961905841 3:130262207-130262229 AATAAAAAACAGGATTACAAAGG + Intergenic
962419122 3:135212609-135212631 CCCTAGAAACAAGATAACAAGGG - Intronic
963826648 3:149962535-149962557 CCTGAGAAACAGGACATCAAAGG + Intronic
964585930 3:158301960-158301982 CCCAAAAAACAAAAAAACAAAGG - Intronic
965040148 3:163497524-163497546 TCTAAATAACAGAATAAAAAGGG - Intergenic
965291135 3:166882423-166882445 CTCAAAAAACTGGATATCAAAGG + Intergenic
966435847 3:179883064-179883086 TCTAAAAAAAAGGAGCACAAAGG + Intronic
967125776 3:186423197-186423219 CCTAAGAAACAGGAAATAAAAGG + Intergenic
969996138 4:11315224-11315246 TCTAAAAAAAAGGAAAAGAAAGG + Intergenic
971120746 4:23701908-23701930 TATAAAAAACAGGAAAATAAAGG + Intergenic
972118388 4:35667931-35667953 CCTAGATAAAAGGATAAAAATGG - Intergenic
972451349 4:39202114-39202136 CCTGAAAAACAGAATAGAAAGGG - Intronic
972857738 4:43127942-43127964 ACAAATAAACAGGAAAACAAAGG - Intergenic
973054700 4:45641279-45641301 CCTTAACAACTGGATAGCAAAGG - Intergenic
973101071 4:46271951-46271973 AATAAAAAACAGGTAAACAAGGG - Intronic
973548389 4:52005607-52005629 AAAAAAAAACAGGAAAACAAAGG + Intronic
975252888 4:72199630-72199652 CCTAAAAAACAGACTCAAAAGGG + Intergenic
976858054 4:89628201-89628223 AATATAAAACAGGCTAACAAGGG - Intergenic
979870731 4:125817208-125817230 CCTCAGTAACAGGATAAAAATGG - Intergenic
981505535 4:145495211-145495233 CCTGAAATAGAGGATAAAAAAGG + Intronic
981625073 4:146746211-146746233 CTTAAAAAAAAAGATATCAAAGG + Intronic
981884406 4:149656087-149656109 TCTGAAAAACAGGAAAACTAAGG + Intergenic
982596921 4:157397258-157397280 CCGAGAAAACAGGAAAAAAAAGG + Intergenic
982622003 4:157719927-157719949 CCTGAAAAAAGGGGTAACAAAGG + Intergenic
983103086 4:163650259-163650281 ACTAATAAAAAGGATAAAAAGGG + Intronic
984362297 4:178750478-178750500 CCTAAATAAGGGGATAACAAGGG - Intergenic
984467363 4:180117811-180117833 ATTAAAAATCAGGTTAACAAAGG - Intergenic
985230478 4:187810760-187810782 CCTAAAAAAGAAGATTAAAAAGG - Intergenic
985336053 4:188896104-188896126 CCTAAAAATCATGTTTACAAAGG - Intergenic
986901981 5:12447022-12447044 CCAAACAAAAAGGAAAACAAAGG - Intergenic
987200980 5:15577903-15577925 CATAACAAACAAGATAACAAGGG - Intronic
987231778 5:15901536-15901558 ATTTAAAAACATGATAACAAGGG - Intronic
987740079 5:21895946-21895968 CCCAAGCACCAGGATAACAATGG + Intronic
987951670 5:24684548-24684570 TCTAAGAGACAGGAAAACAATGG + Intergenic
988784227 5:34551172-34551194 ATTTAAACACAGGATAACAATGG - Intergenic
989225517 5:39023355-39023377 GCAAAAAAAAAAGATAACAACGG + Intronic
990110947 5:52323758-52323780 ACTAAAAAACAAGAGAAAAAAGG - Intergenic
990622906 5:57579411-57579433 CCTAAATCACAGGAAACCAATGG - Intergenic
990811144 5:59725006-59725028 CATAAAATTCAGGATAATAATGG + Intronic
991989108 5:72320102-72320124 CCCAAAAAACAGAATAATCAGGG + Intronic
992178518 5:74174162-74174184 CTTAAGAAACAGGAAAAAAAAGG + Intergenic
993017434 5:82550985-82551007 CCTAAAAACCATTTTAACAAGGG - Intergenic
994997274 5:107079678-107079700 CTTAAAAAATAGGATAAGAAAGG - Intergenic
995157994 5:108938564-108938586 CCTAAGAGACAGGGTAGCAAGGG + Intronic
997147073 5:131446905-131446927 TCAAAAGAATAGGATAACAATGG + Intronic
997419400 5:133753940-133753962 TCTATAAAATAGGATAAAAAAGG + Intergenic
997940907 5:138156467-138156489 CCATAAAAACAGGAAAAAAATGG + Intronic
999658515 5:153834079-153834101 GCAAAAAAAAAGGAAAACAAAGG + Intergenic
1000062592 5:157670369-157670391 GCTTAAAAAGAGGATAACAGTGG + Intronic
1000843422 5:166250441-166250463 CCTAAAGACCAGGATTACAAAGG + Intergenic
1001498236 5:172205835-172205857 CCAAAACAAAAGGGTAACAATGG + Intergenic
1002832293 6:833778-833800 ACTAAAACACAGGCTAAAAAAGG - Intergenic
1003293249 6:4800813-4800835 CGTCATAAACAGGAAAACAACGG - Intronic
1003883664 6:10501301-10501323 ACTGAAAAACAGGAAAAAAATGG - Intronic
1003884127 6:10505509-10505531 CCCGAAAAAAAGGATCACAATGG + Intronic
1004114845 6:12756920-12756942 CCTAAAAAACGGTCTAAAAAAGG - Intronic
1008022054 6:46589915-46589937 CCTATAAAGCAGGTTAGCAAAGG + Intronic
1008204979 6:48643806-48643828 CCTAAAAAAGGGGATATCAGAGG + Intergenic
1008690135 6:53969625-53969647 ACTAAGAAACAGGAAAACAAGGG - Intronic
1008860642 6:56145485-56145507 ACTAAAAACCAGGAAAATAAAGG + Intronic
1009428832 6:63543908-63543930 TCTTAAAAACAGAATAACAAGGG - Intronic
1009798017 6:68496569-68496591 AAAAAAAAACAGGAAAACAAAGG + Intergenic
1013058804 6:106611936-106611958 CTTTATACACAGGATAACAATGG + Intronic
1013421996 6:109975709-109975731 ACTAAGAAACACGTTAACAACGG - Intergenic
1013971867 6:116029876-116029898 CTTAAAAATCAGGTTAAAAAAGG - Intronic
1014319848 6:119913602-119913624 CCTTAAAAACAGGAAAACCAAGG - Intergenic
1014477111 6:121887357-121887379 CTTAAAAAACAAGTAAACAATGG + Intergenic
1015438354 6:133217409-133217431 CCAAAAAAACACGATCAAAACGG - Intergenic
1015780500 6:136860715-136860737 ATTAAAAAACACAATAACAAAGG - Intronic
1016515923 6:144893021-144893043 CTTAAAAAACAAGATCACAAAGG + Intergenic
1016709867 6:147157170-147157192 CCAAAGAAACAGGCTAAGAAGGG + Intergenic
1017264866 6:152431870-152431892 CTTAAAAAACAGCAAAACAAAGG - Intronic
1017332371 6:153214793-153214815 TCTGAAAAACAGAATAATAAGGG - Intergenic
1018321413 6:162613288-162613310 CCTAAAAAACAGGTTTACTTTGG - Intronic
1019267086 7:123792-123814 CTTAGAAAACAGGAAAATAAAGG + Intergenic
1020214245 7:6177573-6177595 CCTGAAAAACAGGATTCCAGAGG + Intronic
1023647981 7:42338805-42338827 CCTAAAGAAAATGAGAACAAAGG + Intergenic
1023652384 7:42386006-42386028 CCTAAATAACAGCATAGCAATGG + Intergenic
1024482398 7:49877549-49877571 CATAAAAAAAAGGAAGACAAAGG - Intronic
1024625351 7:51203619-51203641 CCTAAAAAAAAAGAAAAAAATGG + Intronic
1027352870 7:77329374-77329396 CCTAGAAAACAGGAAAAAGAAGG - Exonic
1027893813 7:84014691-84014713 CTTAAAAGAAAGAATAACAATGG - Intronic
1028507011 7:91581840-91581862 CCTAAAAACCAGGAGCACAGGGG + Intergenic
1028758356 7:94464491-94464513 TTTAAAAAAAAGGAAAACAAGGG - Intergenic
1030596601 7:111547514-111547536 GCAAAAAAGCAGGATAAAAAGGG - Intronic
1031116741 7:117677227-117677249 CCCAAAACACAGGATATAAATGG - Intronic
1031315446 7:120252735-120252757 TCTTAAAAACAGGAAAACAGGGG - Intergenic
1031523335 7:122793541-122793563 CCTTAAAGACAGCATATCAATGG + Intronic
1035927867 8:3748366-3748388 CCTCAAATACAAGATAGCAAGGG + Intronic
1035947383 8:3980585-3980607 CATAAAAAACAAATTAACAAGGG - Intronic
1036198366 8:6743960-6743982 CTTTCAAAACAGGAGAACAAAGG + Intronic
1040534259 8:48293750-48293772 TCAAAAAAAAAGGATAATAAGGG - Intergenic
1040820022 8:51546238-51546260 CCTAAAAATCCAGATCACAAGGG + Intronic
1042258176 8:66828296-66828318 TCTAAAAAACTGGTTAAAAATGG - Intronic
1042458024 8:69028376-69028398 CATAGAAAATAAGATAACAAAGG - Intergenic
1043179655 8:77071064-77071086 CTAAAAAAACAGGAGTACAATGG - Intergenic
1043413504 8:80024817-80024839 GCTAGAAAACAGGATAAAACAGG + Intronic
1043654701 8:82648084-82648106 CCTAAAAAACGGGGTATAAATGG + Intergenic
1045613769 8:103880809-103880831 CCTGTAAAACATGAAAACAAAGG - Intronic
1045674735 8:104594312-104594334 CCTATAAAACAGGAAAAAAACGG + Intronic
1045702974 8:104888253-104888275 CAGAAAAAACAGGATTACAAAGG - Intronic
1045958352 8:107936448-107936470 AAGAAAAAACAGAATAACAATGG - Intronic
1046142838 8:110117729-110117751 CCTAATAAACAGAATAATATAGG + Intergenic
1046416723 8:113924949-113924971 CCTAAAAAGCATGATGAAAAAGG + Intergenic
1047604473 8:126461229-126461251 CTTAAAAAACTGGGTATCAATGG + Intergenic
1047660357 8:127027035-127027057 CATAAAAAAGAAAATAACAATGG + Intergenic
1048185999 8:132241299-132241321 ACTCAAAAACATGAAAACAATGG - Intronic
1048343491 8:133558340-133558362 CCATAAAATCTGGATAACAATGG - Intronic
1048558684 8:135508834-135508856 CCTAAACAACAGGAAAAAAGAGG - Intronic
1048637606 8:136315018-136315040 CCTAAACAACATGAAAATAATGG - Intergenic
1050439076 9:5641565-5641587 CCTAAAAAATAGCATGAAAAGGG - Intronic
1050448113 9:5748875-5748897 TCTAAAGAACAGAATAACAGTGG - Intronic
1050742482 9:8837855-8837877 CTTATAAAACAGGCAAACAAAGG - Intronic
1052739410 9:32378939-32378961 TATAAAATACAAGATAACAATGG + Intergenic
1053221967 9:36319770-36319792 CCAAAAAAAAAGGAAAATAAAGG - Intergenic
1053892850 9:42712133-42712155 CCTAAACATTAGGATACCAAAGG - Intergenic
1056427631 9:86493027-86493049 GCTAAAAACCAGGATTACAAAGG - Intergenic
1057708593 9:97416744-97416766 ACTAAAATACAGCATAACATAGG - Intronic
1060076629 9:120596335-120596357 TCTAAAAAAAAGGATAATAAAGG - Intergenic
1060090562 9:120739000-120739022 CTTAAAAAATAGAATAAAAATGG + Intergenic
1061309266 9:129751791-129751813 CCTAGAAAACAGGATGACTATGG + Intronic
1185861145 X:3580833-3580855 CCTCAAAAACAGGAGAAAAGAGG - Intergenic
1186050302 X:5585113-5585135 CCTAAACAGCAGCAAAACAAAGG + Intergenic
1187192342 X:17046722-17046744 CACAATAAACAGGGTAACAAGGG - Intronic
1187567865 X:20470245-20470267 TTTAAAAAATATGATAACAATGG + Intergenic
1188117422 X:26262598-26262620 TCAAAAAAACAGCATAAAAAAGG + Intergenic
1188290231 X:28378619-28378641 CATAAAGAACAGGAAAACCATGG + Intergenic
1192002950 X:67175658-67175680 TCTTAAAGACAGCATAACAATGG + Intergenic
1192532861 X:71904156-71904178 CCTAAAAATGGGGATAACAGTGG - Intergenic
1193100587 X:77606954-77606976 CCTAAAAAACTGGGTATCAGAGG + Intronic
1193282139 X:79665243-79665265 CCAAAAAAACACAATAACAGTGG + Intergenic
1193420604 X:81278420-81278442 CCTATAAAACAGGAAAAAAAGGG - Intronic
1193491364 X:82152877-82152899 ATTAAAAAACAGGCAAACAATGG + Intergenic
1193758580 X:85438716-85438738 CTTAAAGAACAGCATACCAATGG + Intergenic
1193790001 X:85806255-85806277 TCTTAAAGACAGCATAACAATGG + Intergenic
1194007895 X:88519910-88519932 TCTTGAAGACAGGATAACAATGG + Intergenic
1194269955 X:91800316-91800338 GCTTAAAAACAGAATAATAAAGG - Intronic
1194323322 X:92479271-92479293 TCTCAAAGACAGCATAACAATGG + Intronic
1195141604 X:101965905-101965927 CCTTAAAAATAGCAAAACAATGG - Intergenic
1196510683 X:116508139-116508161 CCTGAAATACATGAGAACAAAGG - Intergenic
1196986492 X:121278879-121278901 CCTAAAAAACAGGGTATAGAAGG + Intergenic
1198518640 X:137431005-137431027 CCTGAAACACAGGAGAATAAGGG - Intergenic
1199404611 X:147442523-147442545 GCAAAAAAACAGGAGAACACTGG + Intergenic
1200587197 Y:5021755-5021777 GCTTAAAAACAGAATAATAAAGG - Intronic
1200631424 Y:5592431-5592453 TCTCAAAGACAGCATAACAATGG + Intronic
1200759143 Y:7020849-7020871 TCTAAAATAAAGGAAAACAAAGG - Intronic
1201965696 Y:19732208-19732230 CCAAAAAAACAGGAGAGCTAAGG + Intronic