ID: 908436343

View in Genome Browser
Species Human (GRCh38)
Location 1:64110551-64110573
Sequence AAAAAACAGGATAACAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 0, 2: 4, 3: 83, 4: 859}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908436336_908436343 12 Left 908436336 1:64110516-64110538 CCCATCCTCATCTTTCTTCTGCT 0: 1
1: 0
2: 3
3: 58
4: 758
Right 908436343 1:64110551-64110573 AAAAAACAGGATAACAAAGGAGG 0: 1
1: 0
2: 4
3: 83
4: 859
908436335_908436343 22 Left 908436335 1:64110506-64110528 CCATCTAATTCCCATCCTCATCT 0: 1
1: 0
2: 2
3: 37
4: 384
Right 908436343 1:64110551-64110573 AAAAAACAGGATAACAAAGGAGG 0: 1
1: 0
2: 4
3: 83
4: 859
908436338_908436343 7 Left 908436338 1:64110521-64110543 CCTCATCTTTCTTCTGCTTGCTT 0: 1
1: 1
2: 2
3: 99
4: 1074
Right 908436343 1:64110551-64110573 AAAAAACAGGATAACAAAGGAGG 0: 1
1: 0
2: 4
3: 83
4: 859
908436337_908436343 11 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436343 1:64110551-64110573 AAAAAACAGGATAACAAAGGAGG 0: 1
1: 0
2: 4
3: 83
4: 859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908436343 Original CRISPR AAAAAACAGGATAACAAAGG AGG Intronic
900012121 1:123619-123641 AAAAATGAGGATATCTAAGGAGG - Intergenic
900042181 1:479630-479652 AAAAATGAGGATATCTAAGGAGG - Intergenic
900063621 1:714626-714648 AAAAATGAGGATATCTAAGGAGG - Intergenic
900753628 1:4417667-4417689 AAGAAACAAGTCAACAAAGGAGG + Intergenic
901724012 1:11226046-11226068 AAAATACATTATAACCAAGGTGG + Intronic
902902079 1:19524732-19524754 AAAAAAAAAGAAAAAAAAGGTGG + Intergenic
903548831 1:24143525-24143547 AAATAACTGGACAACAGAGGGGG + Intergenic
904215722 1:28917166-28917188 AAAAATAAGGAGAATAAAGGTGG - Intronic
904527368 1:31143981-31144003 AAAAAAAAGGATAAGAAATAGGG + Intergenic
904556534 1:31368528-31368550 AAAGAACAGGATCACACAGGTGG - Intronic
904732100 1:32601477-32601499 AAAAAAAAGGAAAACAAACTAGG + Exonic
906343812 1:45003125-45003147 AGAAAATAGGAGAAAAAAGGCGG + Exonic
906749883 1:48249323-48249345 CAATAACAGGACAATAAAGGAGG - Intergenic
906850309 1:49241895-49241917 AGAAAACAGGATAATGAAAGAGG + Intronic
907572655 1:55498213-55498235 AGAAAACAGGACAAGAAAAGAGG - Intergenic
907648399 1:56267630-56267652 AAAAAATAGAATAAAAATGGAGG + Intergenic
907652902 1:56312679-56312701 AAAAAACAGGATAGCCAAGAAGG + Intergenic
907888023 1:58611831-58611853 AAAACAGAGGATAAAAAAGAGGG - Intergenic
908436343 1:64110551-64110573 AAAAAACAGGATAACAAAGGAGG + Intronic
908487352 1:64607789-64607811 AAAAAACAGAATCACTAAGAAGG - Intronic
908691780 1:66788498-66788520 AATTAACAGGATAAAATAGGCGG - Intergenic
908987681 1:70044391-70044413 AAAATAAAGAAAAACAAAGGAGG - Intronic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909891987 1:81018788-81018810 AAAAAAGAGGAAAAAACAGGAGG + Intergenic
910135606 1:83965366-83965388 AAGAGACAGAAGAACAAAGGAGG - Intronic
910890573 1:92015136-92015158 AAAAAACAAAAAAACAAATGAGG + Intergenic
911586529 1:99697403-99697425 AAAAAACAAGATAAGATTGGAGG - Intergenic
912116735 1:106416729-106416751 AGAAAACAGGTTAAAGAAGGAGG + Intergenic
912769344 1:112448777-112448799 AAGAAACAGCATTAGAAAGGTGG - Intronic
912821474 1:112871246-112871268 AGGAAACAGGATAACAAAACAGG + Intergenic
915226785 1:154417572-154417594 AAAAGAAAGGATATCTAAGGAGG - Intronic
916164564 1:161954251-161954273 AACAAACAGAAAAACAAGGGAGG - Intronic
916891351 1:169115191-169115213 AAAAAAAAAGAAAAAAAAGGGGG + Intronic
917725249 1:177821541-177821563 AAAAAAAAGGAGAGAAAAGGGGG + Intergenic
917864466 1:179180121-179180143 AAAAAACAAAAAAAAAAAGGGGG + Intronic
918522900 1:185434434-185434456 AAAAAAAAGAATAACAGAAGGGG - Intergenic
918605711 1:186423399-186423421 AAAAATCAGGAACACAAGGGTGG + Intergenic
918736319 1:188067814-188067836 ACAAAACAGCATAACCAAGTGGG - Intergenic
918935912 1:190921457-190921479 AAAAAACAGGAAATCAAAAAAGG + Intergenic
919301928 1:195781367-195781389 AAAAAACAAAAGAAAAAAGGAGG + Intergenic
919893746 1:201995140-201995162 AAAAGATAGGGAAACAAAGGTGG - Intronic
920820580 1:209376789-209376811 AAAAAACTGCTTAAAAAAGGAGG + Intergenic
920839034 1:209538321-209538343 AAAAAACAGCATTCCAAAGTAGG - Intergenic
921074531 1:211689037-211689059 AAAAAAAAGGGAAAAAAAGGGGG + Intergenic
922014522 1:221631540-221631562 AAAAGAAAGGAAAGCAAAGGAGG - Intergenic
922127330 1:222740993-222741015 AGTAAACAGGATAACAAACCCGG - Intronic
922260548 1:223940116-223940138 AAAAATGAGGATATCTAAGGAGG - Intergenic
922277071 1:224089015-224089037 AAAAAAAAGGATAATGAAGAAGG + Intergenic
922593503 1:226796603-226796625 AAAAAACAACAAAAAAAAGGTGG + Intergenic
922736523 1:227985614-227985636 AAAAATGAGGATATCTAAGGAGG + Intergenic
923185709 1:231571247-231571269 AAAAAACAGAGTAAAAAGGGAGG - Intronic
923326987 1:232888703-232888725 AGAGCACAGGATAAGAAAGGAGG + Intergenic
923522887 1:234749814-234749836 AAAAAAAAGGAAAAGAAAAGGGG - Intergenic
923570772 1:235112309-235112331 AAAAGTCAAGTTAACAAAGGAGG + Intronic
924105865 1:240648629-240648651 AACAAACAAAATAAAAAAGGTGG - Intergenic
924341724 1:243042310-243042332 AAAAATGAGGATATCTAAGGAGG - Intergenic
1062849395 10:731694-731716 AAAAAAAAGGAAAGGAAAGGAGG + Intergenic
1063057056 10:2517066-2517088 AAGAAGCAGGATAAGGAAGGAGG - Intergenic
1063239617 10:4154240-4154262 AAAAAAAGAGATAACAAAGAGGG + Intergenic
1064125054 10:12652217-12652239 AAAAAACAGAATAAAGATGGGGG - Intronic
1064203825 10:13306073-13306095 AAGAAACAGGGAAACATAGGAGG + Intergenic
1064691170 10:17919993-17920015 AAATCACAGGAGATCAAAGGGGG - Intergenic
1065397622 10:25256738-25256760 AAGGAACAGGACAACAAAGGAGG - Intronic
1066476122 10:35748961-35748983 AAAAAACAGGAAATCATGGGAGG + Intergenic
1066553265 10:36582743-36582765 ATAAAGCAGGATAATAAAGAAGG + Intergenic
1066734755 10:38463237-38463259 AAAAATGAGGATATCTAAGGAGG + Intergenic
1066826762 10:39602217-39602239 AAAAAAAAAGAAAAGAAAGGTGG - Intergenic
1067328055 10:45288447-45288469 AAGACACAGGATAAGATAGGAGG - Intergenic
1067578360 10:47421859-47421881 TAGGAACAGGACAACAAAGGAGG + Intergenic
1067580369 10:47441593-47441615 CAGAAACAGGACAATAAAGGAGG + Intergenic
1067846011 10:49721811-49721833 AAAAAACACGATTACAAGGTGGG + Intergenic
1068116646 10:52743682-52743704 AAAAAATGGGATAAGGAAGGAGG - Intergenic
1068164585 10:53312353-53312375 TCAAAACAGGATGACAAAGTAGG - Intergenic
1068671902 10:59731996-59732018 AAAAAAAAGGAAAAAAAGGGGGG - Intronic
1068812119 10:61267841-61267863 AAAAAAAAGGGAAAGAAAGGGGG + Intergenic
1069011539 10:63379023-63379045 AAAAGACAGGATAGGAAGGGAGG - Intronic
1069176968 10:65302888-65302910 AAAAAATAGGATAACTAACCAGG + Intergenic
1069507576 10:69014686-69014708 AAAAGAAAGAATAACTAAGGTGG - Intronic
1069548663 10:69347029-69347051 AAAAAAAAGGAAAAGAAAAGAGG - Intronic
1069570760 10:69493069-69493091 AAAAAACAGGATACCAGGGTGGG - Intronic
1069852034 10:71413416-71413438 AAAAAACAAAAGAACAAAGTTGG - Intronic
1070005094 10:72416197-72416219 AAAAAACAGGAAAATAATAGAGG + Intronic
1070016094 10:72532977-72532999 AAAAGGCAGGATCACAAAAGAGG - Intronic
1070904311 10:80058402-80058424 AAAAAACAGGAAAAAGCAGGAGG + Intergenic
1071426343 10:85557793-85557815 AAAAAAAAGGAAAGCAAAGAAGG + Intergenic
1071661454 10:87506111-87506133 ACAAAACAGAAGAAAAAAGGAGG - Intronic
1071848099 10:89540405-89540427 AAAAAAGATGATAAAGAAGGTGG - Intronic
1071852433 10:89587576-89587598 AACAAACTGGAAATCAAAGGAGG + Intronic
1071854147 10:89606518-89606540 AAAAAACATGAAAAGAAAAGTGG - Intronic
1072214727 10:93278617-93278639 AAAAAATAGTATAACAAAATTGG - Intergenic
1072214752 10:93278860-93278882 AAAAAAAAGGATAATCAGGGAGG - Intergenic
1072756852 10:98027172-98027194 AAAAAAAAAGAGAACAAAGGGGG + Intronic
1072839143 10:98751103-98751125 CAAAAACAGGATAAAAAGGTGGG - Intronic
1073515598 10:104072960-104072982 AAAACACATGATAACAATGTGGG - Intronic
1073852347 10:107635439-107635461 AATGAACAGCATCACAAAGGTGG - Intergenic
1073861720 10:107751034-107751056 AAAAAAGAGGATGAAACAGGTGG - Intergenic
1073956601 10:108879025-108879047 AAAAGATAAGTTAACAAAGGAGG - Intergenic
1075010008 10:118859660-118859682 AAAAAAGAGGAAAAGATAGGAGG - Intergenic
1075878501 10:125828236-125828258 AGCAAACAGGATAACAAACATGG + Intronic
1076162818 10:128258599-128258621 AAAAAACAGAATGAGAAAAGAGG - Intergenic
1076302737 10:129440339-129440361 AAAAGACAGGATAAGGAAGAAGG - Intergenic
1076784086 10:132740739-132740761 AAACTACAGGATAATAAAGAAGG + Intronic
1076968452 11:115825-115847 AAAAATAAGGATATCTAAGGAGG - Intergenic
1077193858 11:1269409-1269431 AAAAAACAGTACAACAAAACGGG + Intergenic
1077607136 11:3619974-3619996 AAAAAACAAAAAAACAAAGAAGG + Intergenic
1078026799 11:7703415-7703437 AAAAAAGAGCATTACAAAGAAGG - Intronic
1078092412 11:8273441-8273463 ATAAAACACCATGACAAAGGAGG + Intergenic
1078537716 11:12188037-12188059 AAAAAGCTGGAGAAAAAAGGAGG - Intronic
1078833598 11:15002254-15002276 AAAAAAGAGTAAAACAAATGGGG - Intronic
1078835602 11:15026415-15026437 AAAAATTTGGATAAGAAAGGAGG + Intronic
1078889146 11:15538401-15538423 AAACAACTGGATAAGAAAGAAGG + Intergenic
1079229717 11:18639057-18639079 AAAAAAAAGGAAAAAAAAAGAGG + Intergenic
1079471886 11:20786354-20786376 AAAAAAAAGAAAAAAAAAGGCGG + Intronic
1079512603 11:21228754-21228776 AAAAAAGAGGAGAGGAAAGGAGG - Intronic
1079923351 11:26459559-26459581 AACAAACAAGACAACAAAAGTGG + Intronic
1079927429 11:26511903-26511925 AAAAAACAGGGTACTAAATGAGG + Intronic
1080072157 11:28102114-28102136 AGAAAAGAGGAAAACAAAGAGGG - Intronic
1080712038 11:34758009-34758031 AAAAAGGAGGAAAAGAAAGGTGG + Intergenic
1080726137 11:34901137-34901159 AAAATACAGGAAAACAACAGAGG + Intronic
1080736228 11:35016863-35016885 AAAAAAGATGACAACAAAGTAGG + Intronic
1080814016 11:35736483-35736505 AACAAACAAAATAACAAAGAAGG - Intronic
1080970990 11:37276588-37276610 AACAAACAGAATAACAAACATGG - Intergenic
1081027675 11:38035843-38035865 AAAGAACTGAATAACAAGGGTGG + Intergenic
1081082891 11:38765610-38765632 AGAAAAAAAGAAAACAAAGGTGG + Intergenic
1081502934 11:43684333-43684355 AAAAAGATTGATAACAAAGGTGG + Intronic
1082733307 11:56826451-56826473 AAAAAAAAGAAAAAAAAAGGGGG + Intergenic
1082997658 11:59266305-59266327 AAAAAAAAGGAAAAGAAAAGAGG + Intergenic
1083283816 11:61644812-61644834 TCAAAACAGGATAAAAAAGCAGG - Intergenic
1083360766 11:62106039-62106061 ATAAAACAGGAAAACAAAAATGG - Intergenic
1083583735 11:63841218-63841240 AAAACACAGTAAAAGAAAGGAGG - Intronic
1083600552 11:63944913-63944935 AAAAAAGAAGAGAAAAAAGGAGG + Intronic
1083613081 11:64013660-64013682 AAGATAAAGGATCACAAAGGGGG - Intronic
1085060170 11:73438619-73438641 AAATAACAGGAAAACATTGGAGG + Intronic
1085215909 11:74831699-74831721 AAAAAAAAAAAGAACAAAGGTGG + Intronic
1085453358 11:76651654-76651676 AAAAAACAAGATAACAATTTTGG + Intergenic
1087564675 11:99839115-99839137 AACAAACAAGATTAAAAAGGAGG + Intronic
1087629306 11:100631801-100631823 AAAGAAAAAGATAAAAAAGGAGG - Intergenic
1087926495 11:103924742-103924764 AAAAAACAGTTTTACAAAGCTGG + Intronic
1089869955 11:121663618-121663640 TGAAAACAGGAAAATAAAGGAGG + Intergenic
1090319324 11:125828712-125828734 AAAATAAAGGATATGAAAGGAGG + Intergenic
1091014859 11:132040717-132040739 AAAAAACAGGAGAGCAGAGCGGG - Intronic
1092086243 12:5764703-5764725 AAAAAGCAGGAGAACAGGGGAGG - Intronic
1092721951 12:11450163-11450185 AAAAAACAGGAGACCCCAGGTGG + Intronic
1092906262 12:13102589-13102611 AAAGAACAGGATAACTTAAGAGG - Intronic
1093227191 12:16499445-16499467 AAAAAACAGGGAAACAAATGGGG - Intronic
1093363632 12:18264575-18264597 AAAAAATATCACAACAAAGGAGG - Intronic
1093473060 12:19525481-19525503 AAAAAAAAGGAAAGGAAAGGAGG - Intronic
1093482120 12:19614898-19614920 AAAAAGCAGGAAAACAAAAAAGG - Intronic
1093482330 12:19617268-19617290 AAAAAAAAGAAAAAGAAAGGTGG + Intronic
1093642699 12:21545702-21545724 ATAAAATAAAATAACAAAGGAGG + Intronic
1093755961 12:22852111-22852133 AAAAAAGAACATCACAAAGGGGG - Intergenic
1094575980 12:31685841-31685863 AAAAAAAATAATAACAAATGCGG - Intronic
1094681467 12:32671095-32671117 AAAAAACAGAAAAACAGAGAAGG + Intergenic
1095205872 12:39440553-39440575 AGAAATCAGGATAACAGAGACGG + Intronic
1095371768 12:41476313-41476335 AAGAAACAGCATAACAAACTAGG + Intronic
1095472224 12:42549361-42549383 AAGAAACAAGAAAACAAAGGTGG + Intronic
1095830143 12:46577027-46577049 AAAAAAAAGAATATCAAACGTGG - Intergenic
1096153398 12:49328869-49328891 AAAAAATAGGAAGACAAAGGGGG + Intronic
1096209744 12:49755823-49755845 AAAAAAAAGAAAAAAAAAGGGGG - Intronic
1096307569 12:50491627-50491649 AAAAAAAAAGATAGAAAAGGGGG - Intergenic
1096917758 12:55051585-55051607 AAAAAACAAAAAAACAAAAGTGG + Intergenic
1097355355 12:58594753-58594775 CAACAACAGGTTAACCAAGGTGG + Intronic
1097702627 12:62835627-62835649 ACAAAACAGGCTTACATAGGTGG - Intronic
1097726261 12:63078944-63078966 AAAAAACATGATAAAACAGTAGG - Intergenic
1098081566 12:66791463-66791485 AAAAAACTGTATAACCATGGTGG - Intronic
1098496956 12:71147195-71147217 AAATATCAGGAAAAAAAAGGGGG + Intronic
1098739343 12:74152219-74152241 AAAAAAAAGAAAGACAAAGGAGG - Intergenic
1099172055 12:79376563-79376585 AAGTAACAGGATGAGAAAGGAGG - Intronic
1099437623 12:82662445-82662467 GAAAAATAGGATAAGAAAGAGGG + Intergenic
1099496365 12:83351724-83351746 AAAAGAAAGAAAAACAAAGGAGG - Intergenic
1100349847 12:93770083-93770105 AAAAAAAAAGATAACATAGGAGG - Intronic
1100596578 12:96077444-96077466 AAAACCCAGGAGAACAAAGGTGG - Intergenic
1100957766 12:99928153-99928175 AAGAAACAGGAAAAAAATGGTGG + Intronic
1101363092 12:104046048-104046070 AAAAAGCAAGATAAAAGAGGGGG + Intronic
1101741186 12:107501393-107501415 AAAAAACAAGAAAACAAGGGAGG + Intronic
1102139949 12:110606445-110606467 AACAAAAATGAAAACAAAGGTGG + Intergenic
1102291593 12:111705159-111705181 AAAAAACAGCATATCATAAGAGG - Intronic
1102699730 12:114828657-114828679 AAAATACAGGATTATAAAGCTGG - Intergenic
1102897778 12:116612292-116612314 AAAAAAAAAGAAAAAAAAGGGGG - Intergenic
1104263496 12:127207679-127207701 AAAAAACACAATAATAAAGATGG - Intergenic
1105226648 13:18441068-18441090 AAAAAAAAGAATGATAAAGGAGG - Intergenic
1105582070 13:21707412-21707434 AAAATACAGGAAAATAAAAGAGG + Intergenic
1106543316 13:30709684-30709706 CTAAAATAGGATACCAAAGGTGG - Intergenic
1107030054 13:35841524-35841546 AAAAAAAAGGAAAAAAAAGTAGG + Intronic
1107139086 13:36978181-36978203 AAAAAAAAAAAAAACAAAGGTGG - Intronic
1107608564 13:42088459-42088481 AAATAGCAGTAGAACAAAGGAGG + Intronic
1107625525 13:42278580-42278602 ACAAAATAGGATAAAAAATGTGG - Intronic
1107697188 13:43011842-43011864 AAAAAAAAGAAAAAAAAAGGTGG - Intergenic
1108240800 13:48461646-48461668 AAAAAAAAAGATAAAAAAGTTGG - Intronic
1108546167 13:51496783-51496805 AAAATACAGGAGAACCAAGTAGG - Intergenic
1108624872 13:52218008-52218030 AAAAAAAAGAAAAAGAAAGGTGG + Intergenic
1108661181 13:52588409-52588431 AAAAAAAAGAAAAAGAAAGGTGG - Intergenic
1108725714 13:53178661-53178683 AACAAACAAGATAATAAAAGGGG + Intergenic
1108941213 13:55956194-55956216 AAAAATAAGAAGAACAAAGGTGG + Intergenic
1109844652 13:67971402-67971424 ACAAATTAGGATAACAAATGTGG - Intergenic
1110085395 13:71372708-71372730 AAAAAAAAGGAAAAGATAGGAGG + Intergenic
1110122043 13:71894499-71894521 AAAAAAAAGGATAAAAATGTTGG + Intergenic
1110262910 13:73505925-73505947 AAAAAACATTATACCAAAGGTGG - Intergenic
1110532358 13:76612075-76612097 ACAGAGCAGGATAACAAATGGGG + Intergenic
1110920907 13:81084011-81084033 AAAATACTGGATAACAAATGAGG + Intergenic
1111196182 13:84876711-84876733 AAAAAAAAAGACAAAAAAGGGGG + Intergenic
1111222963 13:85228638-85228660 AAAAAAAATGATGACAAAGAAGG + Intergenic
1111364188 13:87220224-87220246 AAAAAAAAGAAAAACAAAGCTGG + Intergenic
1111392913 13:87622678-87622700 AAATTTCAGGGTAACAAAGGAGG + Intergenic
1111438566 13:88245946-88245968 AAAAATCAGGATAACAATAGAGG - Intergenic
1111650032 13:91078893-91078915 GAAAAACTAGATAACAGAGGAGG - Intergenic
1111715254 13:91871500-91871522 AAAAAAAAGGTTAAAAAAAGAGG + Intronic
1112148909 13:96734401-96734423 CAAAGTCTGGATAACAAAGGTGG - Intronic
1112995578 13:105571022-105571044 CAAAGACAGGACAAAAAAGGGGG + Intergenic
1113230305 13:108206424-108206446 AAGAAAAAGGAAAAAAAAGGTGG + Intergenic
1113274225 13:108710332-108710354 AAACAAAAGTAGAACAAAGGGGG - Intronic
1114119736 14:19658167-19658189 AAAAAAAAGGAAAAAAAAAGAGG - Intergenic
1114436915 14:22714218-22714240 TAAAAACAGTATCACAGAGGGGG - Intergenic
1115041331 14:28932703-28932725 AAAAAAGAGGAGAAAAAAAGAGG - Intergenic
1115178646 14:30595959-30595981 AAAAAACAGGATAAGACACATGG - Intronic
1115343583 14:32318390-32318412 AAAAAAGAGGGGAAAAAAGGGGG - Intergenic
1115438398 14:33403293-33403315 AAAAAAAAGCATAAGAAATGTGG + Intronic
1115485451 14:33907159-33907181 AACAAACAGGAAAACAAACAGGG + Intergenic
1115824570 14:37253532-37253554 AAAAAAAATTAAAACAAAGGTGG + Intronic
1115838349 14:37435437-37435459 AAAAAAAATAATAATAAAGGAGG - Intronic
1116503459 14:45649586-45649608 AACAAAGTGGAAAACAAAGGGGG - Intergenic
1116567525 14:46468327-46468349 AAAAAAGTGGATATTAAAGGTGG + Intergenic
1116631487 14:47340909-47340931 CAGAAACAGCATAACAAAGCGGG - Intronic
1116904875 14:50394797-50394819 AAATAACATGATATCAGAGGGGG - Intronic
1117019987 14:51560479-51560501 AAAAAACAGACAAACAAAGTAGG - Intronic
1117157336 14:52953502-52953524 ACAAAACAAGAAAAAAAAGGTGG + Intergenic
1117439325 14:55745393-55745415 AGGAAACAAAATAACAAAGGTGG - Intergenic
1117640481 14:57793216-57793238 AAAAATGAGCATAAAAAAGGTGG - Intronic
1118356137 14:65015397-65015419 AAAAAAAAAGATAACAAGGCTGG - Intronic
1118818977 14:69332810-69332832 AAAAAAGAAGAAAACAAAGAAGG - Intronic
1118981731 14:70722465-70722487 AAAAAAAAAGAAAAAAAAGGGGG + Intergenic
1119202063 14:72762328-72762350 ATAAAATAGCATAACAAAGTGGG + Intronic
1120176990 14:81304792-81304814 AAAAAACAGAATAACAAGAAAGG - Intronic
1120181551 14:81347916-81347938 AAAAAAAAAGATAATAAAGTAGG + Intronic
1120428551 14:84383134-84383156 AAAAAAAAGAAAAACAAAGCTGG + Intergenic
1120655291 14:87181974-87181996 GAAAAACAGAATAAAAAAGATGG - Intergenic
1120784034 14:88514449-88514471 AAGAAAAAAGAAAACAAAGGGGG - Intronic
1121073316 14:91044874-91044896 AAAAAAAAGAAAAAAAAAGGTGG + Intronic
1121227180 14:92329502-92329524 AAAACACAGAGTAATAAAGGGGG - Intronic
1121585400 14:95059849-95059871 AAAAAAAAGAAAAAAAAAGGTGG + Intergenic
1121785626 14:96658407-96658429 AGAAAGCATGATAAGAAAGGAGG - Intergenic
1121854476 14:97254249-97254271 AAAATACAAGATAAGAAAGGAGG - Intergenic
1122431162 14:101646343-101646365 AAAAAAAAGAACAACAAAGATGG + Intergenic
1122514151 14:102294627-102294649 AAAAAAAAGAAAATCAAAGGAGG + Intronic
1122610912 14:102982949-102982971 GATAAAAAGGAAAACAAAGGAGG + Intronic
1122642059 14:103165676-103165698 AAAAAACAGAAGAGAAAAGGGGG + Intergenic
1123709619 15:22977861-22977883 AAAAGAAAAGAAAACAAAGGAGG + Intronic
1124019608 15:25908392-25908414 TAAAAACAAGATAACAATGCTGG + Intergenic
1124079853 15:26482214-26482236 AAAAAACAAGTTCAGAAAGGTGG + Intergenic
1124174426 15:27409018-27409040 AAAAAAAAGGACCAGAAAGGTGG - Intronic
1124612867 15:31220732-31220754 AGAAAACAGGATAATAATGCAGG - Intergenic
1125122459 15:36178287-36178309 AAAAAAAATGGTAACAAAGGGGG - Intergenic
1125488819 15:40131478-40131500 AAAAAAAAGAAAAACAGAGGGGG - Intergenic
1125840139 15:42792853-42792875 ATAACACAGAATAACAAAGAAGG - Intronic
1125878754 15:43173671-43173693 AGAAAACAGTATGATAAAGGAGG - Intronic
1126045601 15:44636664-44636686 AAAAAACAAAAAAACAAATGTGG + Intronic
1126183610 15:45809937-45809959 ATGAAAGATGATAACAAAGGAGG + Intergenic
1126601438 15:50431962-50431984 TAAGAACAGGGTAAGAAAGGAGG - Intronic
1126615106 15:50570015-50570037 AAAAAACAACAAAAAAAAGGGGG + Intronic
1126760500 15:51965650-51965672 AAAAAACAGGGTAATAAAGATGG + Intronic
1126832564 15:52623161-52623183 AAAAAAAAGGTTTAGAAAGGTGG + Intronic
1127013394 15:54655402-54655424 AAAAAAGAGGAAAAGAAAGAGGG + Intergenic
1127065585 15:55234409-55234431 AAATAATAAGATACCAAAGGTGG + Intronic
1127197479 15:56605180-56605202 CCAAAACAGAATAACAAAGTTGG - Intergenic
1127218587 15:56851701-56851723 AAGAAAAAGAATAACAAAGCTGG + Intronic
1127418190 15:58778109-58778131 AAAAAAAAGTATAACCAAGTAGG - Intronic
1127666853 15:61156192-61156214 AAAAGAGAGGAAAACAAGGGGGG + Intronic
1128059931 15:64728864-64728886 AAAGAAGAAGAAAACAAAGGAGG + Intergenic
1128663328 15:69519397-69519419 AAAAAAAAGAAGAACAAAGGTGG + Intergenic
1128833081 15:70786986-70787008 AAAAAAAAGAAAAAAAAAGGAGG + Intergenic
1128852584 15:70974728-70974750 AAAAAAAAGAACAACAAAGAAGG + Intronic
1128971015 15:72106154-72106176 AGAAAACAGGATGAAAAAGATGG + Intronic
1129089973 15:73138774-73138796 AAAAAACAAAAAAACAAAGGGGG + Intronic
1129486037 15:75873239-75873261 AAAATATAGGATATAAAAGGTGG + Intronic
1130266030 15:82404428-82404450 AAAATACAGGATATAAAAGGTGG + Intergenic
1130505985 15:84542446-84542468 AAAATACAGGATATAAAAGGTGG - Intergenic
1130603231 15:85292379-85292401 AAAAAACAGGATATGTAAGTGGG + Intergenic
1133159611 16:3901874-3901896 AAAAAAAAGAATAACAAAACTGG - Intergenic
1133484353 16:6204394-6204416 AGAAAAAAACATAACAAAGGTGG - Intronic
1133618078 16:7498140-7498162 AAAATGAAGAATAACAAAGGTGG + Intronic
1133689341 16:8198179-8198201 AAAAAAAAGGCTAACAAATGAGG - Intergenic
1133944452 16:10336773-10336795 AAAAAAAAGAATAGCAAGGGTGG - Intronic
1133964394 16:10519789-10519811 AAAAAACAAAAAAAAAAAGGGGG - Intergenic
1134309218 16:13060667-13060689 AAAATACAGGAAATTAAAGGTGG + Intronic
1134772900 16:16825870-16825892 AAAACACAGGAAGTCAAAGGAGG - Intergenic
1135299909 16:21317385-21317407 AAAAAACAGTATCACAAAACTGG - Intergenic
1135394743 16:22122637-22122659 AAAAAACAGGATGAACAAGTTGG + Intronic
1135813630 16:25611941-25611963 AAAAAAAAGGAAAAGAAAAGAGG - Intergenic
1135986953 16:27190828-27190850 AAAGAACAGTGTAACATAGGAGG - Intergenic
1135989054 16:27206223-27206245 AACAAACAGGCTTCCAAAGGAGG - Intronic
1136516459 16:30771643-30771665 AAAAAACAGCATCACACGGGAGG + Intronic
1136581129 16:31151495-31151517 AAAAAAAAGGAAACCAAAGAGGG + Intergenic
1136614172 16:31386210-31386232 AAAAAAGAGAAAAAAAAAGGAGG + Intergenic
1136688643 16:32011454-32011476 AAAAAAAAGGAAAAGAAAGTGGG - Intergenic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1138004965 16:53324749-53324771 AAAGATCAGGAAGACAAAGGAGG + Exonic
1139502380 16:67377630-67377652 AAAAAAAAGAAGAAAAAAGGCGG - Intronic
1139812109 16:69629604-69629626 AAAAAATGGGATAACAAAATTGG - Intronic
1140444899 16:75018386-75018408 ACAAAAGAGGATTACAAAAGAGG - Intronic
1140615334 16:76656194-76656216 GAAAAACAGGATGAAAAAGGGGG - Intergenic
1140755534 16:78063208-78063230 AAAAAAAAAGAAAAAAAAGGGGG + Intronic
1140793667 16:78415432-78415454 AAGTTACAGGATAACATAGGAGG - Intronic
1141118123 16:81329146-81329168 AAACAACAGGAGAAAAAGGGTGG - Intronic
1141724951 16:85781859-85781881 AAATACCAAGATCACAAAGGTGG - Intronic
1141977881 16:87529682-87529704 AAAAAAAAGGATTGCAAAGAGGG + Intergenic
1142279337 16:89139575-89139597 AAAAAACAGAAAAAAAAAGGAGG - Intronic
1142332602 16:89464244-89464266 AAAAAAAAAGATCACAATGGTGG + Intronic
1142452224 16:90183295-90183317 AAAAATGAGGATATCTAAGGAGG + Intergenic
1203091438 16_KI270728v1_random:1216473-1216495 AAAAAAAAGGAAAAGAAAGTGGG - Intergenic
1142584970 17:966710-966732 AAAAAATTGGGCAACAAAGGAGG + Intronic
1142588532 17:989675-989697 AAAAAAAAGAATTACAAATGGGG - Intergenic
1142670796 17:1486507-1486529 AAAAAACAGAAAAAAAAAGGAGG - Intronic
1142955014 17:3515649-3515671 AAAAAACAGAAAAGAAAAGGTGG + Intronic
1143229121 17:5336706-5336728 AAACAACAGGAAAAAAAAGGAGG - Intronic
1143263126 17:5615006-5615028 AAAAAACAGGAGAGAAAAGAGGG - Intronic
1143389664 17:6552748-6552770 AAAAAAAAGAAAAAGAAAGGTGG - Intronic
1143696444 17:8623617-8623639 AAAAAAAAAGAAAACAAAGATGG + Intronic
1143745748 17:8992771-8992793 AAAAAAAAGGAAAGGAAAGGAGG + Intergenic
1143801297 17:9384115-9384137 AAAAAAAAAAATAACAAATGAGG - Intronic
1143949089 17:10618790-10618812 AAAAAAAAAAAAAACAAAGGGGG - Intergenic
1145012059 17:19374137-19374159 TAAAAGCAGGAAAACAAAAGAGG - Intronic
1145817070 17:27803093-27803115 AAAAAAAAGGAAAAAAAAGAGGG + Intronic
1145868981 17:28258269-28258291 AAAAAAGAGCAAAGCAAAGGTGG + Intergenic
1146028844 17:29346939-29346961 AAAAAAGAAGAAAACAAAGAGGG - Intergenic
1146559930 17:33859357-33859379 AAGAACCAGGAAAAGAAAGGAGG + Intronic
1146974484 17:37099183-37099205 TAAACACAGGTTAACAGAGGAGG + Intronic
1147361055 17:39930291-39930313 AAAAAAAAGGAAAAAAAAGAGGG + Intergenic
1147750595 17:42730139-42730161 TAAAAACAAGATACCACAGGAGG - Intronic
1147810418 17:43165716-43165738 AAAAAAAAGGAAAAAAAGGGGGG - Intergenic
1148133888 17:45279425-45279447 AAAAAAAAGAATACCAAAGAAGG - Intronic
1148943204 17:51233984-51234006 AAAAAAAAAGAAAACAAAGTTGG + Intronic
1149011294 17:51859411-51859433 AGGGAACAGGATAACAAACGTGG - Intronic
1149933638 17:60781264-60781286 AAAAAAAAGGAAAAAAAAGCTGG - Intronic
1150020316 17:61605582-61605604 AAAAAAAAGAAGAACAAAGTTGG + Intergenic
1150538460 17:66071425-66071447 AAAAAACAGTATGACAAAGCTGG + Intronic
1151003618 17:70407350-70407372 GAAAAACTGAATAACAAATGGGG - Intergenic
1152184430 17:78845287-78845309 AAAAAAAAGGAAAGAAAAGGAGG + Intergenic
1152997173 18:418539-418561 AAATCACAGGATAAGATAGGAGG + Intronic
1153043194 18:833196-833218 AAAAAGCAGGATAGCAAAGGGGG + Intergenic
1153373807 18:4353203-4353225 AAAACAAAGCAAAACAAAGGAGG - Intronic
1154291555 18:13112533-13112555 AAAACACAACATAACACAGGAGG - Intronic
1154526731 18:15298407-15298429 AAAAAAAAGAATGATAAAGGAGG + Intergenic
1154927579 18:20952778-20952800 AAAAAACAAAAAAAAAAAGGGGG + Intronic
1154960611 18:21304968-21304990 AAAAAAAAGATTAACACAGGAGG - Intronic
1155047130 18:22112792-22112814 AAAAAAAAGTATAACAAAGGAGG - Intergenic
1155218559 18:23663954-23663976 AAAAAATAGTATAAAAATGGAGG + Intergenic
1155286840 18:24297983-24298005 AAATCACAGGATAAGATAGGAGG + Intronic
1155542990 18:26886469-26886491 TAAAAACAGTATCACAGAGGTGG + Intergenic
1155824490 18:30422303-30422325 AAAAAAAAGAAGAAGAAAGGAGG + Intergenic
1155985669 18:32228057-32228079 AAAAAAAAGGAAACCAAAGCAGG - Intronic
1156196140 18:34776224-34776246 AAGGAGCAGGATAACAAAGGTGG + Intronic
1156510395 18:37631698-37631720 ACAAGACAGGATAAGAAAAGTGG - Intergenic
1156569176 18:38233283-38233305 AAAAAAAAGAAAAAGAAAGGTGG + Intergenic
1156680942 18:39587662-39587684 CAAAAACAGTAAAACAAAGTGGG - Intergenic
1157014133 18:43689524-43689546 GATAAATAGGATAACATAGGAGG + Intergenic
1157418532 18:47526210-47526232 AAAAAGGAGGCAAACAAAGGCGG - Intergenic
1157635678 18:49151541-49151563 AAAAAGCAGTATTACAAAAGAGG - Intronic
1157708553 18:49830845-49830867 AAAAAAAAGGAAAACAAAATTGG + Intronic
1158426265 18:57342216-57342238 ACAAGGCAGGATAACAAAGAAGG + Intergenic
1158555640 18:58472529-58472551 AAAATAAAGGAAAATAAAGGTGG + Intergenic
1158577833 18:58654991-58655013 ATAAAACAGCAACACAAAGGAGG - Intergenic
1158777011 18:60594972-60594994 AAAAAACAGGCTGAGAGAGGTGG + Intergenic
1158989843 18:62856915-62856937 AAAAAACAGCTTGAGAAAGGGGG - Intronic
1159188091 18:65005272-65005294 CAAAAACATGGTAACAAAGTAGG - Intergenic
1159430963 18:68352734-68352756 AAATAAAAGCATAACAAAGTAGG - Intergenic
1159504830 18:69322437-69322459 AAAAGACAAAACAACAAAGGGGG + Intergenic
1159793046 18:72808068-72808090 AGAAAAGAGGATAATAATGGAGG - Intronic
1160222904 18:76990140-76990162 AAAAATCCAGATTACAAAGGAGG - Intronic
1160262805 18:77310974-77310996 ACAGAACAGGATGCCAAAGGTGG - Intergenic
1160645260 19:185771-185793 AAAAATGAGGATATCTAAGGAGG - Intergenic
1161488575 19:4549260-4549282 ACACACCAGGAGAACAAAGGGGG - Intronic
1161784967 19:6318858-6318880 AAAAAAAAAGAAAACAAAGATGG + Intronic
1161970657 19:7578040-7578062 AAAAAAGAGGACACCGAAGGAGG + Intergenic
1162422458 19:10573646-10573668 AAAAAAAAGGAAAAAAAAGCAGG - Intronic
1162776375 19:12982233-12982255 AATAAACAAGAGAAAAAAGGAGG - Intergenic
1163028594 19:14528949-14528971 ACAAAACAGAAAAACAAAGTGGG + Intronic
1163059296 19:14746825-14746847 GAAAAACAAGATAATAAAGATGG - Intronic
1163300709 19:16444180-16444202 AAAAAAGAGGAAAAGAAAGGGGG + Intronic
1163431107 19:17268261-17268283 AAAAAAGAGGAAAAAAGAGGGGG + Intronic
1164022793 19:21323483-21323505 AACAAACAAGATTAGAAAGGAGG - Intronic
1164121682 19:22271385-22271407 AAAAAAAAGGGAAAAAAAGGGGG - Intergenic
1164169386 19:22711430-22711452 AAAAAAAAGGAGAATAAAGGAGG - Intergenic
1164242208 19:23399542-23399564 GAAAAAAAGGAAAACAAAAGGGG + Intergenic
1164758905 19:30712968-30712990 AAAAAAGAGGAAAAAAAAGTGGG + Intronic
1164789348 19:30962496-30962518 ATAAGACAGGATAAGAGAGGAGG - Intergenic
1164926479 19:32133725-32133747 AAAAAACAGGACAGCAACGGGGG + Intergenic
1165130130 19:33626769-33626791 AAAAAAAAGGAAAAAAAAAGCGG - Intronic
1165505490 19:36225738-36225760 AAAAAAAAGAATCACAAAGCAGG - Intronic
1165657191 19:37544408-37544430 AAAAAAAAGGAAAAGAAAGACGG - Intronic
1166085092 19:40469246-40469268 AAAAAAAAGACTAACAAAGGAGG - Intronic
1167198424 19:48046960-48046982 AAAAAAAAGGAAAGAAAAGGGGG - Intergenic
1167356064 19:49004980-49005002 AAAAAACAGGAAAGAAAATGAGG + Intronic
1167869094 19:52352656-52352678 AAAAAACAGGAAAAAAAAAGTGG - Intronic
1167892835 19:52556285-52556307 AAAAAACAGGATGGCGAAAGTGG - Exonic
1167894654 19:52571105-52571127 AAAAAAAAAGATAAGAAAGCAGG + Intronic
1167904572 19:52648140-52648162 AAAAAAAAAGATAAGAAAGCAGG - Intronic
1167911289 19:52704004-52704026 AAAAAACAGGCTGAGAAAAGTGG + Exonic
1167918831 19:52764504-52764526 AAAAAAAAGGATATCAAAGCTGG - Exonic
1167937872 19:52922552-52922574 AAAACAAAAGATAACAAAGCAGG - Intergenic
925403105 2:3590056-3590078 AAAAAAAAGAATAAAATAGGAGG - Intergenic
926245463 2:11119835-11119857 AAAAAAAAGGAAAAGAAAAGAGG + Intergenic
926443246 2:12912071-12912093 GAAAATCAGGATAAGAAAGAAGG + Intergenic
926954370 2:18278202-18278224 AAAAACAAGGATAACAAATAGGG + Intronic
926988488 2:18650618-18650640 AAAAAAAAGGATAGGAAAAGAGG + Intergenic
927014065 2:18937894-18937916 AAATAAATGGATAACAAATGTGG - Intergenic
927725960 2:25423202-25423224 AAAAAACAAAAAAACAAAGAAGG + Intronic
927735183 2:25514332-25514354 CAAAACCAGAATAACAAAGGAGG + Intronic
927793140 2:26026567-26026589 AAAAAACAAAAAAACAAAGCCGG - Intergenic
927794754 2:26038183-26038205 AAAAAACAAACAAACAAAGGAGG - Intronic
928156268 2:28879917-28879939 AAAAAAAAGGAAAAAAAAAGTGG - Intergenic
928555222 2:32416829-32416851 AAATAAAAGGAAAAGAAAGGAGG - Intronic
928871538 2:35986895-35986917 AAAATATAGGATTACAAAAGAGG + Intergenic
929929552 2:46242004-46242026 TAAAAACGGCATAACAAAGTAGG - Intergenic
930471314 2:51818013-51818035 AAGAAACAGGAAAAGAAAGAAGG + Intergenic
930977787 2:57485268-57485290 AAGAAACAGGAAATCAAACGTGG + Intergenic
931017293 2:57997902-57997924 AAAAAAAAAGAAAAAAAAGGAGG + Intronic
931262328 2:60631138-60631160 AACAAACAACAAAACAAAGGAGG - Intergenic
931630934 2:64297976-64297998 AAATAAAAACATAACAAAGGGGG - Intergenic
931908815 2:66871754-66871776 AAAATCCAGGAGAATAAAGGAGG + Intergenic
931921736 2:67024275-67024297 AAAAAAGAGGAAAAGAAAGATGG - Intergenic
932093628 2:68828026-68828048 AAATAACAGGATAGCAAACATGG + Intergenic
932346147 2:70996514-70996536 AAAAAAAAAGATTACAAAGCAGG + Intergenic
933242411 2:79936941-79936963 AGCAAACAGGATAAGAAAAGTGG - Intronic
933281087 2:80333611-80333633 AAAAAAGAAGAAAAAAAAGGTGG - Intronic
933997788 2:87682585-87682607 AAAGGACAGGAAAAGAAAGGAGG + Intergenic
934534379 2:95121129-95121151 CAAAAACAAAAAAACAAAGGAGG + Intronic
934968191 2:98741509-98741531 AAAAAATAGTATCACACAGGTGG - Intergenic
935053407 2:99543918-99543940 AAAAAAAAGGAAAAAAAAGCAGG - Intergenic
935927319 2:108083628-108083650 AAAAAGGAGGATAAGAATGGAGG + Intergenic
936256227 2:110916077-110916099 AAAATACAGGGTAACAAAACAGG - Intronic
936296065 2:111268285-111268307 AAAGGACAGGAAAAGAAAGGAGG - Intergenic
936392148 2:112085106-112085128 AATAAACAAAAGAACAAAGGAGG - Intronic
936419707 2:112351989-112352011 AAAAAAAAAGAAAAAAAAGGCGG - Intergenic
936519569 2:113202898-113202920 AAATAACAGGTCAACAAAGAGGG + Exonic
936643175 2:114339052-114339074 AAAAAGCAAAATAAAAAAGGTGG - Intergenic
937161141 2:119762275-119762297 AAAAAAAAGTATAATAAAGTGGG + Intronic
937684984 2:124685881-124685903 AAAAAACAGCAAAAAAAATGAGG - Intronic
938367633 2:130747432-130747454 AAAGGACAGAATGACAAAGGGGG + Intergenic
938525825 2:132129767-132129789 AAAAAAAAGAATGATAAAGGAGG + Intergenic
938843810 2:135187783-135187805 AAAAGAGGGAATAACAAAGGGGG - Intronic
938849294 2:135244165-135244187 ACAAAACAGAACAACAAAGAAGG + Intronic
939201002 2:139033876-139033898 AATAAACATGATAACTAAGTGGG - Intergenic
939588831 2:144038466-144038488 AAAAGACATGAGAACAAATGTGG + Intronic
939779152 2:146423082-146423104 AAAAAAAACAACAACAAAGGGGG + Intergenic
939941543 2:148357626-148357648 AAAGAACAAGAAAAAAAAGGTGG - Intronic
939987519 2:148845212-148845234 AAAAAAAAAGAAAAAAAAGGAGG - Intergenic
940184880 2:150972750-150972772 AAATCACAGGATAAGATAGGAGG - Intergenic
940254815 2:151717844-151717866 AAAAAAAAAAAGAACAAAGGAGG - Intronic
940413854 2:153397652-153397674 AAAAAAAAGTATCACCAAGGGGG + Intergenic
941174128 2:162176364-162176386 AAAACACAGAATAAAAGAGGGGG + Intronic
941600908 2:167543664-167543686 AAAATAAAGGATAAAATAGGGGG + Intergenic
941612665 2:167680550-167680572 TAAAAACAGGATAAAAATAGAGG - Intergenic
941705117 2:168650074-168650096 AACAAACACAAAAACAAAGGAGG + Intronic
941947067 2:171111163-171111185 AAGAAAGAAAATAACAAAGGAGG + Intronic
942319243 2:174721937-174721959 AAATAAAAACATAACAAAGGAGG - Intergenic
942392668 2:175512178-175512200 AAAAAACATGATGACAAAGAAGG + Intergenic
942634702 2:177990744-177990766 AAAAAAAAGGAAAAAAAAGGCGG + Intronic
942924321 2:181413449-181413471 AAAAAAAAAGAAAGCAAAGGTGG + Intergenic
943842626 2:192600998-192601020 TAAAAACAGTATTCCAAAGGAGG - Intergenic
944712187 2:202344505-202344527 AAGAAACAAGATAACAAAGAAGG - Intergenic
945186751 2:207147255-207147277 GAAACACAGGATAACATAAGTGG + Intronic
945262867 2:207860937-207860959 TAAATACAGGAAACCAAAGGGGG + Intronic
945381224 2:209143498-209143520 ATAAAACAAAATAAAAAAGGAGG + Intergenic
945466366 2:210174476-210174498 GAAAAACAAAGTAACAAAGGGGG - Intergenic
945470059 2:210218271-210218293 AAAAAAAAGCAGAAAAAAGGAGG - Intronic
946687975 2:222290932-222290954 AAAAAAGAGGAGAAGAAGGGGGG + Intronic
946987333 2:225287477-225287499 ATAAAAGAGGAAAACAAAGATGG + Intergenic
947092681 2:226530138-226530160 AAAAAAAAAGAAAACAAAGAAGG - Intergenic
947111031 2:226719858-226719880 AAAAAAAAGAAAAAGAAAGGGGG + Intergenic
947323582 2:228949803-228949825 ATACAACAGGATAACTAATGGGG - Intronic
947368181 2:229417889-229417911 AAAGAACAGGACAGGAAAGGGGG + Intronic
947816063 2:233037872-233037894 AAAAAAAAGGAAAAAAAAGAAGG + Intergenic
948473597 2:238202922-238202944 AAATCACAGGATGACAGAGGAGG + Intronic
948751682 2:240136742-240136764 AAAAAACAGCAAAACACGGGTGG + Intronic
1169368458 20:5010108-5010130 AAAAAAGAGGATATGAAAGAGGG + Intronic
1169490257 20:6065273-6065295 AAAAAAAAGAAAAAAAAAGGAGG - Intergenic
1169566665 20:6861356-6861378 AAAAAAGGGAATAACAGAGGAGG + Intergenic
1169724629 20:8715604-8715626 ACATAACAGAATAGCAAAGGTGG - Intronic
1169753036 20:9014909-9014931 ACAAAACAGATGAACAAAGGAGG + Intergenic
1170081544 20:12482189-12482211 ACAAAACAGACTAACACAGGAGG + Intergenic
1170199631 20:13728937-13728959 AACAAACAGAATAACTTAGGTGG - Intronic
1170798603 20:19571468-19571490 AAAAAGAAGGAGAACAAAGGGGG + Intronic
1171118176 20:22545051-22545073 ACAAACCAGGATGACAAAGGTGG + Intergenic
1171122464 20:22578753-22578775 AAAAAAAAGAATAATAAAGGAGG + Intergenic
1172097885 20:32469345-32469367 AAAAAATAGAAAAATAAAGGAGG - Intronic
1172201172 20:33127100-33127122 AAAAAACAGGAGAAAGAATGTGG - Intergenic
1172690612 20:36786983-36787005 AAAAAAAAGGATAAAAAGGAAGG - Intronic
1172755465 20:37280728-37280750 CGAAAACAGGAGAAAAAAGGGGG - Intergenic
1173960478 20:47067746-47067768 AAAGAAAAGGATAAAAAAGCTGG - Intronic
1173968672 20:47133485-47133507 AAACAACCGGTTAGCAAAGGAGG - Intronic
1174908102 20:54573702-54573724 AAAAAAAAGGATAATAACGTTGG + Intronic
1175124230 20:56739600-56739622 AAACAAAAGGAGGACAAAGGAGG - Intergenic
1175143431 20:56877969-56877991 AATAAATAGGATAACCATGGAGG + Intergenic
1175166617 20:57048657-57048679 AAAAAAAAGGTTCACAAAGGAGG + Intergenic
1175896821 20:62340297-62340319 AAAAAAAAAAAAAACAAAGGAGG - Intronic
1176280252 20:64300450-64300472 AAAAATGAGGATATCTAAGGAGG + Intergenic
1176587764 21:8605562-8605584 ACAAAACAATACAACAAAGGAGG + Intergenic
1176770698 21:13070095-13070117 AAAAAAAAGAATGATAAAGGAGG - Intergenic
1176920244 21:14679490-14679512 GAAAAACTGGATAACAAGAGGGG + Intergenic
1177389799 21:20453210-20453232 CAAAAACAAGATAAAAAAGTGGG - Intergenic
1177581770 21:23032656-23032678 AAAAAACAGAAAAACAAATGTGG - Intergenic
1177642301 21:23858993-23859015 AACTAAGAGCATAACAAAGGAGG + Intergenic
1177970141 21:27778686-27778708 AAATAACAGGTTAACAGAGGGGG - Intergenic
1178050602 21:28742676-28742698 AAAAAAAAGGAAAAAAAATGGGG + Intergenic
1178106351 21:29323524-29323546 ACAAAACAGGAGGAAAAAGGTGG - Intronic
1178155529 21:29849475-29849497 GAAACAAAGTATAACAAAGGAGG - Intronic
1178230347 21:30776554-30776576 AAATAACAGGATAATAAGAGAGG - Intergenic
1178670738 21:34589691-34589713 AAAAGGCAGGAGAACAAAAGGGG + Intronic
1179008787 21:37537180-37537202 AAAAAAAAGGGGAAGAAAGGTGG + Intergenic
1179393515 21:41015710-41015732 AAAAAAGAGGATAAAAAGGCAGG + Intergenic
1179671002 21:42948289-42948311 AAAAAAAAGGAAAAAAAAGGGGG - Intergenic
1179801293 21:43812586-43812608 AAAAGAAAGAAGAACAAAGGAGG - Intergenic
1180270594 22:10582561-10582583 ACAAAACAATACAACAAAGGAGG + Intergenic
1181647305 22:24239341-24239363 AAAAAAAAGGGTAACAGAAGAGG + Intronic
1181720977 22:24774238-24774260 ATAGAACAGGAAAAGAAAGGGGG - Intronic
1182469644 22:30540353-30540375 AAAAAAAAGGAACAAAAAGGAGG - Intronic
1183230087 22:36576638-36576660 AAGAAAGAGGAGAACAAAGATGG + Intronic
1184037869 22:41926914-41926936 AAAAAAAAAGAAAAGAAAGGGGG - Intergenic
1184059308 22:42072524-42072546 GAAAAACAGGAGAAAGAAGGGGG + Intergenic
1184237741 22:43193708-43193730 AAAAAACAAAAGAACAAAGAAGG - Intergenic
1184434060 22:44459364-44459386 AAAAAATAGGCCAACACAGGTGG - Intergenic
1184925383 22:47632858-47632880 AATCCACAGGATAACAGAGGCGG - Intergenic
1184986892 22:48141863-48141885 AACAAACAGGACAGCACAGGTGG - Intergenic
1185270008 22:49925139-49925161 AAAAAAAAGGAAAAGAAAGTGGG + Intronic
949176970 3:1075747-1075769 AAAAAGCAGGATAAGCCAGGGGG - Intergenic
949196852 3:1320987-1321009 AAAAAAAAGTAAAACAAAGATGG - Intronic
950340229 3:12237159-12237181 AAAAAACAGGATTACAAACTAGG + Intergenic
951068080 3:18291122-18291144 GAAAAAAAGGAGAACAAAAGAGG - Intronic
951508134 3:23471947-23471969 AAAAAAAAGGAAAACAAAAATGG + Intronic
951656936 3:25019759-25019781 AAACAACAGGGTACCCAAGGAGG + Intergenic
951674498 3:25221494-25221516 GAAAAACATGATGACAAAGGAGG - Intronic
951820225 3:26800396-26800418 AAAAGACATGAAAAAAAAGGAGG + Intergenic
951837331 3:26997689-26997711 AAAAAAAAGGAAAAAAATGGAGG - Intergenic
952288424 3:31991271-31991293 AAAAAACAGGCTAGGAAAAGTGG - Exonic
953985288 3:47437438-47437460 AAAAAAAAGGAGAATAAAGTTGG + Intronic
954612221 3:51951169-51951191 ATAAAAAAGGAAAAAAAAGGGGG + Intergenic
954625904 3:52021711-52021733 AAAGAACAGGAAAAGGAAGGTGG - Intergenic
955162350 3:56476547-56476569 CAAAAACATGATAACAGAGTTGG + Intergenic
955522417 3:59787865-59787887 AGAAAACAAGATAACATAGCAGG - Intronic
955946834 3:64203608-64203630 AGATAACAAGAAAACAAAGGAGG + Intronic
956143826 3:66172423-66172445 AAAAAAAAGGAAAAGAAAGAGGG + Intronic
956508931 3:69974110-69974132 AAACATCATGATAACAAAGTTGG - Intergenic
956914603 3:73858001-73858023 AAAAAGAAGGAGGACAAAGGGGG + Intergenic
957542587 3:81593010-81593032 AAAAAAGAAAAAAACAAAGGGGG - Intronic
957718219 3:83961419-83961441 TAAAAATAGTAGAACAAAGGTGG - Intergenic
958001465 3:87754934-87754956 AAAAAACAAAATAACAATTGAGG - Intergenic
958435536 3:94091439-94091461 AAAAAAATGAATAGCAAAGGTGG + Intronic
958710000 3:97706773-97706795 AAAAAACAACAAAACAAAGGAGG - Intronic
959155283 3:102659328-102659350 AAAAAAAAGGAAAGGAAAGGGGG - Intergenic
959416954 3:106087193-106087215 AAAAAAAAGGTTAATAAAGAAGG + Intergenic
959441409 3:106379969-106379991 AAATAACAATGTAACAAAGGAGG - Intergenic
960311122 3:116117579-116117601 AAAAGACAGAATAACTAATGTGG - Intronic
960389882 3:117064575-117064597 ATAAAAGAGGAAAACAAAGGGGG + Intronic
960857307 3:122115757-122115779 AAAAAAAAAAAGAACAAAGGTGG + Intronic
961195256 3:124996083-124996105 AAAAAAAAAGAAAACAAATGAGG - Intronic
961299063 3:125910333-125910355 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
962096865 3:132301593-132301615 AAAAAGAAGGAAAAAAAAGGGGG - Intergenic
962270239 3:133972638-133972660 AAAAAACAGGATACCTAAGAAGG + Intronic
962424391 3:135257309-135257331 AAAAAACAGAACAGAAAAGGTGG - Intronic
962433995 3:135347754-135347776 AAAAAAAAGAAAAAAAAAGGTGG - Intergenic
963573890 3:147034180-147034202 AAAAACAAGGAGAACAAAGTCGG + Intergenic
963614362 3:147517137-147517159 AAAAAACAAGAAAACAAATGGGG - Intergenic
964489614 3:157221930-157221952 AAAAAACAAAATAAAAAACGTGG - Intergenic
964724659 3:159802100-159802122 AAAAAACAAAAGAACAAAGAGGG + Intronic
965006096 3:163026514-163026536 AGAAAACAGAATAAGAAAGATGG - Intergenic
965509529 3:169553248-169553270 AAAATAAAGCATAAAAAAGGGGG + Intronic
965540836 3:169869956-169869978 AAAAAACAGAAAAAGAAAGGTGG - Intergenic
965653337 3:170956419-170956441 AAAAAAAAGGATTAAAAAGTGGG - Intergenic
966564382 3:181360362-181360384 AATAATCAGGATAAGAAAAGAGG + Intergenic
966574629 3:181486238-181486260 AAAAAAAAGGAAAAAAAAAGGGG - Intergenic
966596542 3:181728930-181728952 AGAGATCAGGAGAACAAAGGGGG - Intergenic
966636187 3:182136362-182136384 AAACAACAGAATCACAGAGGAGG + Intergenic
966697924 3:182812017-182812039 AAAAAAAAGTAGAAAAAAGGTGG - Intronic
966907472 3:184538330-184538352 AAAAAAAAGGATAATATAGAAGG + Intronic
967156233 3:186695025-186695047 AAGAAAGAGGAGAACAAAAGAGG + Intergenic
967524670 3:190477145-190477167 CAAAAACTGAATAACACAGGAGG + Intergenic
968372422 3:198233755-198233777 AAAAATGAGGATATCTAAGGAGG + Intergenic
968640176 4:1710747-1710769 AAAAAAAAGAAACACAAAGGTGG + Intronic
969828505 4:9777047-9777069 ATCAAACAGAATAACAAAAGAGG - Intronic
969985426 4:11204024-11204046 AAAACACAGGAGAACAGAGCAGG + Intergenic
970007653 4:11427094-11427116 AAAAAAAAGAAAAAAAAAGGAGG - Intronic
970476245 4:16426822-16426844 GAGAAAGAGGATATCAAAGGAGG - Intergenic
971523741 4:27589083-27589105 AAAGAATAGGAAAATAAAGGAGG - Intergenic
971587198 4:28419023-28419045 AAGAAACAAGTAAACAAAGGAGG - Intergenic
971873128 4:32270513-32270535 TAAAAACAAGCTCACAAAGGTGG - Intergenic
972274926 4:37548004-37548026 AAAAAAAAGGAAAAAAAAAGGGG + Intronic
972581994 4:40403242-40403264 TAAACACAGGATTAGAAAGGAGG - Intergenic
973841252 4:54863241-54863263 AAAAAACAGGCTCAGAAATGTGG - Intergenic
974014796 4:56639189-56639211 AAAAAACAAAAAAACAAAAGAGG - Intergenic
974429525 4:61777897-61777919 GAAACATAGGATAACAAAGTGGG + Intronic
974769848 4:66398036-66398058 AAAAAAAAAGATGAAAAAGGAGG - Intergenic
974853352 4:67429714-67429736 AAATACCATGATCACAAAGGTGG - Intergenic
975205536 4:71640474-71640496 AAAAAACAGGGAAAAAATGGGGG + Intergenic
975328573 4:73087947-73087969 AAAAGAGAGGAAAAAAAAGGAGG + Intronic
976186780 4:82449870-82449892 AAAGCACAGGAGACCAAAGGAGG - Intronic
976227069 4:82803149-82803171 AAAAAAAAAGAGAACAAAGTTGG - Intergenic
976393184 4:84526770-84526792 AAAAAACAGAAAAATAAAGAGGG + Intergenic
976610350 4:87024584-87024606 AAAAAGCAGGATCCTAAAGGAGG - Intronic
976909270 4:90280380-90280402 AAAAAACAGGAGATGGAAGGAGG - Intronic
978056103 4:104269429-104269451 AAAAAAATGCATAACAAAAGTGG - Intergenic
978933692 4:114349670-114349692 AAAAAACAGATTAAAAATGGGGG + Intergenic
979261108 4:118646214-118646236 AAAAATGAGGATATCTAAGGAGG + Intergenic
979834000 4:125338840-125338862 TAAAAACAGAAGAATAAAGGTGG - Intronic
979938133 4:126723067-126723089 AAAAAAAAGGTTACTAAAGGTGG + Intergenic
980099734 4:128529681-128529703 AAAAAAGGGGAGAAAAAAGGGGG - Intergenic
980132713 4:128831537-128831559 ACAAACCAGGTTAAAAAAGGAGG - Intronic
980273093 4:130612328-130612350 AAATAAAAGGATAAAAAAGAAGG - Intergenic
980315763 4:131198042-131198064 AAAAAATAGAATATGAAAGGTGG - Intergenic
980317815 4:131227016-131227038 AAAAAACAGAATAAAAATTGAGG + Intergenic
980405667 4:132352121-132352143 ATTCAACAGGCTAACAAAGGAGG - Intergenic
980425707 4:132625224-132625246 CAATAACAGCATAATAAAGGTGG - Intergenic
980812046 4:137895461-137895483 AAAAAAAAGGAAAAGAAAGAAGG + Intergenic
980886448 4:138767701-138767723 AAAAAAAAAGATAGCAAAAGAGG + Intergenic
981047392 4:140277911-140277933 CAAAAATAAGAAAACAAAGGTGG + Intronic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
981618005 4:146663269-146663291 AGAAACTAGGATAACATAGGAGG + Intergenic
981678642 4:147368419-147368441 AGAAAACAGAATAATAATGGTGG - Intergenic
981808665 4:148747692-148747714 AAAAAGTAAGATAAGAAAGGCGG - Intergenic
982264960 4:153530019-153530041 AAAAAAAAGGACAACAGAGATGG - Intronic
982366110 4:154580824-154580846 AAAAAAAAGGAAAAAAAATGGGG + Intergenic
982471312 4:155793839-155793861 AATAACCTGGATATCAAAGGGGG - Exonic
983281844 4:165690644-165690666 AAAAAACATAAAAACAAAGCAGG - Intergenic
983423306 4:167548843-167548865 AAAAAGCAAGAAAACAAAAGTGG - Intergenic
983446095 4:167854892-167854914 AAGAAACAGGTTTACAGAGGTGG + Intergenic
983721872 4:170865087-170865109 AAAAAACAGTGTAAAAAAGCAGG - Intergenic
983945830 4:173584495-173584517 AAAAAACAAAAAAAGAAAGGAGG - Intergenic
984447877 4:179860118-179860140 AAAAAACAGAATAAAAACAGAGG + Intergenic
984679578 4:182592112-182592134 AAAAAAGAAGAAAAGAAAGGTGG - Intronic
984773442 4:183458583-183458605 AAAAAAAAGGAAAAGAAAAGAGG - Intergenic
985074342 4:186198280-186198302 ACAAAACAGAATAACACAGGAGG + Intronic
985276789 4:188245298-188245320 AAAAGACAGGTTAACAAGAGAGG + Intergenic
985353316 4:189090421-189090443 AAAAAAAAGGAAAACAAAATTGG - Intergenic
985564661 5:609276-609298 AGAAGACAGGATAATAAAGTTGG + Intergenic
985811070 5:2086285-2086307 AAATAACAAGAAAACCAAGGAGG + Intergenic
985918731 5:2949215-2949237 AAAAAAAAGGAAAAAAAAAGTGG - Intergenic
986102154 5:4622925-4622947 AAAAAAGAGGAAAATCAAGGAGG - Intergenic
986163079 5:5249027-5249049 AAGAAACAGGATAACCAGAGAGG + Intronic
986303651 5:6499415-6499437 GAAAAGGAGGAGAACAAAGGAGG - Intergenic
987756859 5:22107690-22107712 AATAAAAAGGTAAACAAAGGGGG + Intronic
988020632 5:25615489-25615511 GAAAAACAGAAAAACATAGGAGG + Intergenic
988202549 5:28086118-28086140 AAAAAACAGAATCACAAAATAGG - Intergenic
989339409 5:40356261-40356283 AAGTCACAGGATAACATAGGAGG - Intergenic
989557573 5:42815018-42815040 AAAAAACAGGAAAAAAAAAAGGG + Intronic
990575840 5:57122669-57122691 AAAAAACAAAAAAACAAATGGGG + Intergenic
991172044 5:63639494-63639516 GAAAAATAAGACAACAAAGGAGG + Intergenic
991305953 5:65176109-65176131 AAAAAAAAGGGAAAAAAAGGGGG + Intronic
991336349 5:65551947-65551969 AAAAAAAAATAGAACAAAGGCGG - Intronic
991351779 5:65726862-65726884 GAAAAACAGGAGAACACAGGGGG - Intronic
991729153 5:69566486-69566508 GAAAAAAAGAAAAACAAAGGAGG + Intronic
991805585 5:70421635-70421657 GAAAAAAAGAAAAACAAAGGAGG + Intergenic
991865800 5:71061388-71061410 GAAAAAAAGAAAAACAAAGGAGG - Intronic
992111274 5:73496663-73496685 AAAGAACAGGAGAAAAAAGTAGG + Intergenic
992238844 5:74743745-74743767 AAAAAGCAGTATAACAAAGCGGG + Intronic
992312397 5:75513552-75513574 AGGAAACAGGATAAAAAGGGTGG - Intronic
992371286 5:76146615-76146637 AAGTAACAGGATAAGATAGGAGG - Intronic
992408866 5:76485468-76485490 AAAGAAAAGTATAACCAAGGGGG - Intronic
992709671 5:79438655-79438677 AGAAACCAGGTTAATAAAGGAGG + Intronic
993584785 5:89710974-89710996 AAAAAAAACAGTAACAAAGGAGG + Intergenic
993861016 5:93137190-93137212 AAAAAAGAGGTTATCAAAGTAGG - Intergenic
993864711 5:93178504-93178526 AAAAAAGAGTTTAGCAAAGGAGG - Intergenic
994121975 5:96124901-96124923 AAAAGACAGGGTAAACAAGGTGG - Intergenic
994630657 5:102282502-102282524 AATAAAAAATATAACAAAGGAGG + Intronic
994681119 5:102888778-102888800 AAAAAAAAGGAAACAAAAGGAGG - Intronic
995005543 5:107190093-107190115 GAAAAACAGAATAAAAAAGGGGG + Intergenic
995635711 5:114187804-114187826 AAAAAAAAAGAAAAAAAAGGGGG - Intergenic
995788574 5:115858690-115858712 AGAAAACTGGAGAATAAAGGTGG - Intronic
996407912 5:123124903-123124925 AAAAAAAAGTAAAACAAAGTGGG + Intronic
996465560 5:123798623-123798645 TTCAAAAAGGATAACAAAGGTGG + Intergenic
996628070 5:125594339-125594361 AAAAAGCAGGAAGACAAATGTGG + Intergenic
996822662 5:127647982-127648004 AAAAATTAGGAAAACAAATGGGG + Intergenic
997332025 5:133070974-133070996 AATAGGCAGAATAACAAAGGAGG - Intronic
998026091 5:138818114-138818136 AAGAAAAAGGAAAAAAAAGGGGG - Intronic
998596104 5:143532096-143532118 AAAAAAGAGGATGAAGAAGGTGG - Intergenic
998708201 5:144789488-144789510 AAAAAAAAACATAATAAAGGAGG + Intergenic
998866276 5:146506065-146506087 AAAAAAAAGGATAAAAAGGCCGG - Intronic
998881397 5:146648876-146648898 ACAAGACTGGATAACAAAGATGG + Intronic
998936076 5:147232451-147232473 AAAAAACAATATAACAGTGGTGG - Intergenic
999510153 5:152241679-152241701 AAAGAAAAGGATAAAAAAAGAGG - Intergenic
999746920 5:154599692-154599714 AAAAAAAAAGATACCCAAGGTGG - Intergenic
999971839 5:156871905-156871927 AATTAACAGAATAACAGAGGGGG + Intergenic
1000004650 5:157172086-157172108 AAAAAACAGAAGAAAACAGGAGG + Intronic
1000486897 5:161857991-161858013 AAAAAAAAGGAAAGCAAAAGAGG + Intronic
1000588722 5:163132086-163132108 AAAAAAAAGAATGAGAAAGGGGG - Intergenic
1000810322 5:165853706-165853728 AAAAAAAAGGAAAAGAAAGATGG - Intergenic
1000970517 5:167709193-167709215 AAAAGACAGGACTACAAAGCAGG - Intronic
1001094966 5:168768927-168768949 GAAAGACAGGAAAACAAATGGGG + Intronic
1001195234 5:169667156-169667178 AAAAAACAGAAAAACAATCGAGG - Intronic
1001911652 5:175523794-175523816 AAAATACAGTAAAACAAAAGAGG - Intronic
1002731662 5:181339299-181339321 AAAAATGAGGATATCTAAGGAGG + Intergenic
1002752868 6:134795-134817 AAAAATGAGGATATCTAAGGAGG - Intergenic
1003258942 6:4498561-4498583 AATGAACAGAAAAACAAAGGTGG + Intergenic
1004088554 6:12475451-12475473 ATAAAAAAGAAAAACAAAGGTGG - Intergenic
1004442564 6:15667792-15667814 AAAAAGCAGGAAAAAAAAGAAGG + Intergenic
1004595256 6:17093647-17093669 AAAAAATAAAATAACAAAGTCGG - Intergenic
1004990202 6:21128550-21128572 ATAAAACATGAAAACAAAAGAGG - Intronic
1005625938 6:27662471-27662493 AAAAAAAAGGTAAACATAGGCGG + Intergenic
1005712535 6:28515702-28515724 GAAAAACAGGACAAGACAGGAGG + Exonic
1005966010 6:30726883-30726905 AAAAAAAAGGATAACTAGGCGGG + Intergenic
1006101595 6:31689219-31689241 AAAACAAGGGATAACATAGGGGG - Intronic
1006115511 6:31774168-31774190 AAAAAAAAGGATAAAAAGGATGG + Intronic
1006234558 6:32617330-32617352 AAAAAAAAGGAAAACACAGGTGG - Intergenic
1008091985 6:47303308-47303330 TAAAAACAAGAAAACTAAGGGGG - Intronic
1008359664 6:50600525-50600547 ACAGAACAGGAAAACAGAGGAGG + Intergenic
1008633070 6:53382334-53382356 AAGAAACAGGATGAAAATGGTGG - Intergenic
1008648154 6:53537078-53537100 AAAGAACAGTGTAACAAAGGAGG - Intronic
1008818989 6:55608600-55608622 AATTAAGAGGATAAGAAAGGAGG - Intergenic
1009368761 6:62876608-62876630 TAAAAACAATATCACAAAGGGGG - Intergenic
1009369401 6:62881263-62881285 TAAGAACAGTATCACAAAGGGGG - Intergenic
1009444464 6:63724237-63724259 AAACAATAGCAGAACAAAGGTGG - Intronic
1009510340 6:64543312-64543334 AAAAAACAGTATTAAAATGGAGG + Intronic
1009602360 6:65818537-65818559 AAAAACCAGGAAAACAAAAAAGG - Intergenic
1009870222 6:69444633-69444655 AAAAAACAGAATAGAAAAGCTGG - Intergenic
1010275817 6:73967275-73967297 AAAAAAAAGAAAAAAAAAGGGGG + Intergenic
1010341436 6:74757773-74757795 AAAAACTAAGTTAACAAAGGAGG + Intergenic
1010397239 6:75406439-75406461 AAATTACAGGAATACAAAGGAGG - Intronic
1010576730 6:77540935-77540957 AAAAAAAAGGATAATATATGGGG + Intergenic
1011851390 6:91633856-91633878 AAAAAAAAGAAGATCAAAGGAGG + Intergenic
1012077236 6:94704577-94704599 AAAATACAGAACAAGAAAGGGGG + Intergenic
1012293925 6:97495586-97495608 AAGAAACAGGCAAACAAAAGTGG - Intergenic
1012345476 6:98180208-98180230 GAAAGACAAGAGAACAAAGGAGG - Intergenic
1012852549 6:104464497-104464519 AAAAAAAAAGAAAACAAAGCAGG + Intergenic
1013767183 6:113588889-113588911 AATAAGCAAGAAAACAAAGGAGG + Intergenic
1013784701 6:113766345-113766367 AAAACAGAGGAGAACAAAGGGGG + Intergenic
1014178649 6:118358940-118358962 AAAAAACAGGAAAACAATAGAGG + Intergenic
1014229165 6:118882831-118882853 AAAAAAAAGGATAAAAAACGAGG + Intronic
1014430226 6:121361518-121361540 AAGAAACAGGATAATATAAGAGG - Intergenic
1014477112 6:121887360-121887382 AAAAAACAAGTAAACAATGGTGG + Intergenic
1014575115 6:123059805-123059827 AAGAATCAGGATACAAAAGGTGG - Intronic
1014908391 6:127059028-127059050 AAAAAAGAGGTTAAAAAAAGAGG - Intergenic
1016352949 6:143187507-143187529 GAAAAACAGGTTAAAAAATGTGG - Intronic
1017130234 6:151102330-151102352 GAAAAACTGGAAAACAAAGAAGG - Intergenic
1017391412 6:153943687-153943709 AAAAAAGACGATAGCAAAAGTGG + Intergenic
1017499686 6:155012250-155012272 AAAGAACAGGATAAGAAATGTGG - Intronic
1017796970 6:157853793-157853815 AAAAAAAAAAACAACAAAGGTGG + Intronic
1017834018 6:158160201-158160223 AAAAAAAAGGACAACAAAAGGGG - Intronic
1018140095 6:160823166-160823188 GAAAAACAGGAAATCAAAAGAGG - Intergenic
1018325639 6:162664716-162664738 AAAAAACAGCATCAAAAAGTGGG - Intronic
1018519959 6:164637152-164637174 ATAAAAAAGGAAAACAAAGAAGG + Intergenic
1019035643 6:169055174-169055196 AAAAAAGAGGCAAAGAAAGGGGG - Intergenic
1019042615 6:169119257-169119279 AAAAAACAGAAGAGAAAAGGGGG + Intergenic
1019267089 7:123795-123817 AGAAAACAGGAAAATAAAGGGGG + Intergenic
1020344614 7:7149456-7149478 AAATAACAGGATTAGCAAGGTGG - Intergenic
1020701369 7:11487914-11487936 AAAAATCAGGATAACTCAAGAGG - Intronic
1020757266 7:12218225-12218247 AAAAAAAAGTATAACAAATGAGG - Intronic
1020769905 7:12377482-12377504 AAAAAATAGGAGAAAAAAAGAGG + Intronic
1020824934 7:13015691-13015713 CAAATACAAGATAAAAAAGGAGG - Intergenic
1021289263 7:18823050-18823072 AAAACACAGGCTATCAAAGAGGG + Intronic
1021438540 7:20650555-20650577 AAAAAAAAGGAAAAGAAAAGTGG - Intronic
1021965445 7:25913909-25913931 AAAAAAAATAATAACAAAAGGGG - Intergenic
1022063484 7:26825277-26825299 AAAAAAGAGGAAATCAAAGGTGG - Intronic
1022070233 7:26905847-26905869 AAAAAAAAGGGAAACAAAGAAGG + Intronic
1022169655 7:27813131-27813153 AAAAAAAAGCAGAACAAAGTTGG - Intronic
1022584624 7:31594858-31594880 AAAAAAAAGAAAAAAAAAGGGGG + Intronic
1022881519 7:34592701-34592723 ACAAAACAGGATAAGACAGAAGG + Intergenic
1023341587 7:39227259-39227281 AAAAAAAAGGAAAATAAAAGAGG - Intronic
1024182194 7:46907845-46907867 AAGAAACAGGATGTCTAAGGTGG - Intergenic
1024186626 7:46955007-46955029 AAAAAACAGGATTTTAATGGAGG + Intergenic
1024601098 7:50982441-50982463 TAAAAACAGGACAAAGAAGGTGG - Intergenic
1026835615 7:73637065-73637087 AAAAAAAAGAATAACAAACTGGG + Intergenic
1026913569 7:74106763-74106785 AAAAAAGAGGATGACAGAGCAGG + Intronic
1027247095 7:76374673-76374695 AAAAAAAAAAATTACAAAGGAGG - Intergenic
1028109141 7:86917811-86917833 AAAAAACACAAAAACAAAGCAGG + Intronic
1028122352 7:87070487-87070509 AAAAAGTAGGAAAACAAGGGAGG + Intergenic
1028134757 7:87213765-87213787 AAAAAAGAAGAAAACAAAGACGG - Intronic
1028259783 7:88648863-88648885 AAAAAAAAGGAAAAAAATGGAGG - Intergenic
1028328299 7:89555460-89555482 AAAAAAAAAGATAAGAAAGGAGG - Intergenic
1028443252 7:90888737-90888759 AAAAAACAGGCTGACAAAGTGGG - Intronic
1028576003 7:92351704-92351726 AAAAAACAAAAAAAAAAAGGAGG - Intronic
1028609181 7:92689957-92689979 AAAAAAAACGATAAAAAAGTGGG - Intronic
1029091707 7:98053545-98053567 AAAAAAAAAGAAAACCAAGGAGG - Intergenic
1029638212 7:101800138-101800160 GAAAAATAGAATAACAAAGTAGG + Intergenic
1030175986 7:106654087-106654109 AAAATATAGGAAAACATAGGGGG + Intergenic
1030472949 7:109990335-109990357 AAAAAACAGCATAAGTATGGAGG - Intergenic
1030596598 7:111547511-111547533 AAAAAGCAGGATAAAAAGGGGGG - Intronic
1031211485 7:118834122-118834144 ATGAAAAAGGAAAACAAAGGAGG + Intergenic
1031465218 7:122101516-122101538 AAAAGACAGAATGACAAAGATGG + Intronic
1031559661 7:123222922-123222944 AAAAAAAAGGGTAACAAAATTGG - Intergenic
1031797240 7:126190527-126190549 AAAAAAAATAATAACAAAGCTGG + Intergenic
1031913601 7:127542473-127542495 AAAAAACAAGATTAGAAAGTTGG + Intergenic
1032564259 7:132925234-132925256 AAAAAAAAGAAAAAAAAAGGAGG + Intronic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1033178576 7:139151372-139151394 AAAAAATAAAATAAAAAAGGAGG + Intronic
1033184739 7:139217383-139217405 ATAAAAAAGGATAACAAAACTGG - Intergenic
1033463360 7:141567800-141567822 AAAAAGTAGCATAAGAAAGGAGG + Intronic
1034190254 7:149208177-149208199 AAAAAACAAAAAAACAAGGGAGG - Intronic
1034839436 7:154382059-154382081 AAAAAAAAGGAAAAAAAAAGGGG - Intronic
1034915871 7:155038574-155038596 AAAAAAAAGGAAAACACACGGGG - Intergenic
1035511854 8:194959-194981 AAAAATGAGGATATCTAAGGAGG - Intronic
1035891808 8:3352872-3352894 AAAAAACACGAAAACACATGGGG + Intronic
1035947380 8:3980582-3980604 AAAAAACAAATTAACAAGGGGGG - Intronic
1035984266 8:4408800-4408822 AAAAAATAGCACAATAAAGGGGG + Intronic
1036142510 8:6221316-6221338 AAAAAACAGCACAACCATGGTGG - Intergenic
1036839027 8:12101180-12101202 AAAAAAAATAATAATAAAGGGGG - Intergenic
1036860816 8:12347423-12347445 AAAAAAAATAATAATAAAGGGGG - Intergenic
1037155313 8:15692367-15692389 AAAAAAAAAAAAAACAAAGGGGG - Intronic
1037202163 8:16268446-16268468 AGAAAACAGGAAAACAAACCAGG - Intronic
1037304345 8:17489657-17489679 AAGACACAGGATGACATAGGAGG - Intergenic
1037530917 8:19772581-19772603 AAACAAAAGGAAAAAAAAGGTGG + Intergenic
1038049691 8:23797018-23797040 CAAAAAAAGGATAACAAATTTGG - Intergenic
1038434266 8:27523919-27523941 AAAAAACAGGAATAGAAAAGGGG - Intronic
1038788558 8:30645410-30645432 TAAAAGCAGGATGACAAAGCAGG - Exonic
1038957677 8:32485108-32485130 AAAAAAAAGAAAAAGAAAGGAGG - Intronic
1039217822 8:35292702-35292724 AAAAAAAAGGAAAAAAAAGGAGG - Intronic
1039263007 8:35793015-35793037 ATCATATAGGATAACAAAGGAGG + Intronic
1039674260 8:39642700-39642722 AAACAACAAGAAAACAAAGCTGG - Intronic
1039794570 8:40901632-40901654 AAACAAGAGGAAAACAAAGGGGG + Intergenic
1040020976 8:42740716-42740738 TAGGTACAGGATAACAAAGGAGG + Intergenic
1040070449 8:43182761-43182783 AAAAAAAGGGAGAACAAAGGGGG + Intronic
1040601452 8:48888402-48888424 AAAAAACAGAAGAACAGAGGTGG - Intergenic
1040776888 8:51055978-51056000 AAAAAAGAGGTTAACAAATATGG - Intergenic
1041619059 8:59944095-59944117 AAAAAAAAAGAAAAAAAAGGAGG + Intergenic
1041780123 8:61568752-61568774 AGAGATCAGGATAACAAGGGAGG + Intronic
1042085765 8:65107015-65107037 AATATACAGGATATCAAAGGAGG + Intergenic
1042162853 8:65914330-65914352 AAAATCAAGGATAACAAAAGGGG + Intergenic
1042239047 8:66644203-66644225 AAAAAACAGAAGAAAAGAGGAGG + Intronic
1042473570 8:69219303-69219325 AAAAAACACTATTACAAAGTGGG + Intergenic
1042544463 8:69938681-69938703 AAAAAAGAGGATAGGAAAAGAGG + Intergenic
1043317244 8:78937933-78937955 AAGTTACAGGATATCAAAGGAGG - Intergenic
1043320602 8:78980994-78981016 AAAGAAGAGGATGAAAAAGGAGG - Intergenic
1043451452 8:80371530-80371552 AAAACACAAGATAACAAAGTTGG + Intergenic
1044310679 8:90688530-90688552 AACAAACAGCAAAACAAATGGGG + Intronic
1044735574 8:95274957-95274979 AAAAAACAATATGAAAAAGGGGG - Intergenic
1044798217 8:95925789-95925811 CAAAAAAAGGATTTCAAAGGGGG - Intergenic
1045214644 8:100135523-100135545 GAAAAAGAGCATAAGAAAGGGGG + Intronic
1045674738 8:104594315-104594337 ATAAAACAGGAAAAAAACGGGGG + Intronic
1045740450 8:105352516-105352538 AAAAAACAATGTAAAAAAGGAGG - Intronic
1046223336 8:111243623-111243645 AAAGAGCAGGATAAGTAAGGTGG + Intergenic
1046657156 8:116907204-116907226 TAAAATCAGGATAGCAGAGGAGG + Intergenic
1047585520 8:126268280-126268302 GCAAAGCAGGATAACAAAGAAGG - Intergenic
1047783833 8:128134451-128134473 AAAAAAAAGGATAAGAAATAGGG - Intergenic
1048072591 8:131038580-131038602 AAAAAAAAGGAGGAGAAAGGAGG + Intronic
1050091548 9:2019800-2019822 AAAAAACAAGAAAACACTGGAGG - Intronic
1050221218 9:3392527-3392549 AAAAAACAAGAAAACAGAGGGGG + Intronic
1050448254 9:5750615-5750637 AAAAATCATAATAACAAATGAGG + Intronic
1050636023 9:7614098-7614120 AGAAAACAGGAAAACCAAGAGGG - Intergenic
1050720374 9:8581937-8581959 AAAAAAGAGGGAAAAAAAGGAGG + Intronic
1050793374 9:9503935-9503957 AAAATAATGGATAACAAAAGTGG - Intronic
1050911662 9:11079191-11079213 AGAAAAAAGGATAAAAATGGTGG - Intergenic
1050994453 9:12196839-12196861 AAAAAACAACATATCAAAGTAGG - Intergenic
1051047879 9:12897214-12897236 AAAAAAAAGGACAAAAAAGGAGG + Intergenic
1051077646 9:13259536-13259558 AAAATACAAGAACACAAAGGAGG + Intronic
1051147689 9:14046064-14046086 TAAAAAAAGGAAAAAAAAGGTGG - Intergenic
1051425744 9:16930054-16930076 AAAAAACAAAAGAACAAATGTGG + Intergenic
1051802327 9:20949716-20949738 AGAAAAAAAGACAACAAAGGGGG - Intronic
1051814908 9:21094167-21094189 AAATCACAGGAAAACAAATGTGG + Intergenic
1052716612 9:32125970-32125992 AATAAACAAGCTAATAAAGGAGG - Intergenic
1052741255 9:32395117-32395139 AAAAAAAAGTATTACAAAGCAGG - Intronic
1052869973 9:33495150-33495172 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
1053216931 9:36279375-36279397 AAAAAACAGGCTGAGCAAGGTGG - Intronic
1053258810 9:36643047-36643069 AAACAACAGGCAAACAATGGAGG + Exonic
1053434103 9:38064078-38064100 AAAAAAAATGATGACAAAAGAGG - Intronic
1054340120 9:63852495-63852517 TGAAAACAGGAAAACACAGGAGG + Intergenic
1054778893 9:69148359-69148381 AAAAAAAAGTATTACAGAGGGGG - Intronic
1055169687 9:73240786-73240808 AAAAAACAAGAAACCAAATGAGG + Intergenic
1055187978 9:73479253-73479275 AGAAATAAGGATAACAAAGAAGG - Intergenic
1055446501 9:76388964-76388986 AGAAAACAGGACACCAAAGAGGG + Intronic
1055600304 9:77909776-77909798 TAAAATCAGGAAAATAAAGGTGG + Intronic
1055661083 9:78504797-78504819 GAAAAACATAATAAGAAAGGTGG + Intergenic
1056030308 9:82546458-82546480 AAAAAAAAAGAAAACAAAAGTGG + Intergenic
1056042644 9:82684503-82684525 AAAAAAAAGGATTAGAAAGAAGG + Intergenic
1056445290 9:86659917-86659939 AAAAAAAAAAAAAACAAAGGAGG + Intergenic
1056738444 9:89230387-89230409 TAAAAACAGGAAAACAATAGAGG + Intergenic
1056779123 9:89536215-89536237 AACAAACAGGAAAAGAAAAGGGG + Intergenic
1057247340 9:93467856-93467878 AAAATACAAAAAAACAAAGGTGG - Intronic
1057278817 9:93695973-93695995 AAAAAACACAATAAAAATGGGGG + Intergenic
1057671451 9:97093279-97093301 AGAAATCAGTATAGCAAAGGAGG - Intergenic
1057932430 9:99206602-99206624 AAAAAAAAAGAAAACAAAGAGGG + Intergenic
1058075963 9:100651471-100651493 CAAAAACAGGTTAACAAGAGGGG - Intergenic
1058376886 9:104332860-104332882 AAAACACAGCTTAACCAAGGAGG + Intergenic
1058895465 9:109397065-109397087 AAAGGACAGGAAAAAAAAGGGGG + Intronic
1059372023 9:113849010-113849032 AAAAAACAGGATAAAAAGATAGG - Intergenic
1059802888 9:117768576-117768598 TAAAAACAGAATAACCAATGGGG + Intergenic
1060436796 9:123600171-123600193 TAAAAACAGGTTGAAAAAGGAGG + Intronic
1060691287 9:125663248-125663270 AAAAAATAGAATAACAAGGCAGG - Intronic
1061076484 9:128344524-128344546 AAAAAACAAAAAAACAAAGGTGG + Intronic
1061136613 9:128738002-128738024 AAAAAACAAGAAAACAAAACAGG - Intronic
1061136662 9:128738343-128738365 AAAAAACAAGAAAACAAAACAGG - Intronic
1061233313 9:129327598-129327620 AAAAAAAAGGATAAGAGAGCAGG + Intergenic
1061610203 9:131740594-131740616 AAAAAACAAAACAAAAAAGGGGG - Intergenic
1062756068 9:138291809-138291831 AAAAATGAGGATATCTAAGGAGG + Intergenic
1185581839 X:1215795-1215817 AAAAAACAGAAAAACAAAAAAGG - Intergenic
1185592328 X:1285724-1285746 AAAAAAAAGGAAAAGAAAAGAGG + Intronic
1185599535 X:1329435-1329457 AAAAAACAAGAAAACAAAAAAGG - Intergenic
1185635935 X:1551804-1551826 AAAAAAAAAGACAAGAAAGGAGG + Intergenic
1185648933 X:1634659-1634681 AAAAAACAAGAAAAAAAAAGGGG - Intronic
1185690230 X:2148769-2148791 AAAAAAAAGTACAATAAAGGCGG + Intergenic
1185704273 X:2254951-2254973 AAAAAAAAAGAAAAAAAAGGGGG - Intronic
1185794483 X:2953300-2953322 AACAAACAGGAAAAAAAATGTGG - Intronic
1185860147 X:3570911-3570933 AAGACACAGGATAAGATAGGAGG + Intergenic
1186883379 X:13888672-13888694 ACAAAACAGGAAAAAAAAGGGGG - Intronic
1187316511 X:18200517-18200539 AAAAAAGAAGAAAAGAAAGGAGG + Intronic
1187654813 X:21459376-21459398 TTAAAACAGTATAACAAATGTGG - Intronic
1188117423 X:26262601-26262623 AAAAAACAGCATAAAAAAGGAGG + Intergenic
1188205873 X:27357788-27357810 AAATAAGAAGATAAAAAAGGGGG + Intergenic
1188290234 X:28378622-28378644 AAAGAACAGGAAAACCATGGGGG + Intergenic
1188541795 X:31258510-31258532 AAGAAACAGAATTTCAAAGGGGG + Intronic
1188584720 X:31759292-31759314 AAAAAAAAGGATAAGAAAAAAGG + Intronic
1188635333 X:32423213-32423235 AAAAAAAAGAATAATAAAGTTGG - Intronic
1189166904 X:38869442-38869464 AAAAAACAGGCCACCAAAAGTGG + Intergenic
1189624625 X:42883228-42883250 AAAAAAAAGAAAAAAAAAGGTGG + Intergenic
1190637328 X:52448848-52448870 ATAATACAGGAAAACAAACGGGG - Intergenic
1190638381 X:52458780-52458802 ATAATACAGGAAAACAAACGGGG + Intergenic
1190648705 X:52547412-52547434 ATAATACAGGAAAACAAACGGGG + Intergenic
1190678276 X:52801664-52801686 ATAATACAGGAAAACAAACGGGG - Intergenic
1190684997 X:52865037-52865059 ATAGTACAGGAAAACAAAGGTGG - Intronic
1190771103 X:53514926-53514948 AAAAAAAAGGGAAAAAAAGGGGG + Intergenic
1190810725 X:53880930-53880952 AAAAAAAAGGAAAACAAAGGGGG - Intergenic
1190853747 X:54272448-54272470 AAAAAAAAGGATGAAAAAAGAGG + Intronic
1190948808 X:55122176-55122198 AAAAAACAGGATTATAAATTTGG + Intronic
1191000449 X:55654971-55654993 ATAATACAGGAAAACAAAGGTGG - Intergenic
1191858906 X:65650039-65650061 AAAAAAAAAGAGAAAAAAGGAGG - Intronic
1192006528 X:67219537-67219559 AAAAAAAAAGAAAACAAAAGCGG + Intergenic
1192263992 X:69525934-69525956 AAAAAACAGGTGAAAATAGGAGG - Intronic
1193262548 X:79425697-79425719 AGAAGCCAGGACAACAAAGGCGG - Intergenic
1193677438 X:84473142-84473164 AAAAAACAAGAAAACAAAGAAGG - Intronic
1194022108 X:88703659-88703681 AAAAAACCGGATCAAAAAGTGGG + Intergenic
1195305539 X:103579228-103579250 AAAAAAAAGGAAAACATTGGAGG - Intronic
1195343869 X:103929040-103929062 AAGATTCAGAATAACAAAGGTGG - Intronic
1195487468 X:105425582-105425604 AAAAAAAAGGATAACATGAGAGG - Intronic
1195788934 X:108560090-108560112 AAAAAACAGGATAATATCTGAGG + Intronic
1195880815 X:109591029-109591051 AAAAAACAGGAAAAAAAAAGAGG - Intergenic
1196163411 X:112511803-112511825 AAAAAAGAGGAAAAAAAAGATGG - Intergenic
1196392350 X:115221367-115221389 AAAAATCAGGAAAACAATGAGGG + Intronic
1196721885 X:118862253-118862275 CAGACACAGGATATCAAAGGAGG - Intergenic
1196740397 X:119020236-119020258 AAATAACTGGAGAACAAATGAGG + Intergenic
1196753219 X:119136065-119136087 AAAAAAAAGTAGAAGAAAGGGGG + Intronic
1197073414 X:122326821-122326843 AAAAAACTGGCTACCAAAAGGGG + Intergenic
1197127724 X:122967530-122967552 AAATCAGAGGATGACAAAGGTGG + Intergenic
1197344040 X:125310378-125310400 AAAAAAAAGGAATATAAAGGAGG + Intergenic
1197745335 X:129929038-129929060 AAAAAAAAGAAAAACAAAGATGG + Intronic
1197776839 X:130123719-130123741 AAAAAAAAGGAAAACAAGAGGGG + Intergenic
1197816834 X:130506382-130506404 AAAAAACAGTAAAATAAAGATGG - Intergenic
1198532530 X:137560340-137560362 AAAAAGAAGGACAAAAAAGGGGG - Intergenic
1198570511 X:137950475-137950497 AAAAAAAAACATAAAAAAGGGGG - Intergenic
1198580083 X:138053967-138053989 AAACAACACCATAACAAAGTGGG + Intergenic
1199338479 X:146647304-146647326 AAAAGACAGGAAAACAATTGAGG - Intergenic
1199404612 X:147442526-147442548 AAAAAACAGGAGAACACTGGAGG + Intergenic
1199475312 X:148238544-148238566 AATAAACAGGTTACCAAAAGGGG + Intergenic
1200407478 Y:2828059-2828081 AAGAACCAGGATCATAAAGGAGG - Intergenic
1200837979 Y:7751567-7751589 AAAAAACAGGATGAGGGAGGGGG + Intergenic
1201260180 Y:12151576-12151598 AAAAAAAAGGGAAAAAAAGGTGG - Intergenic
1201966803 Y:19745627-19745649 AAAAAACAGAATAGCAATGTAGG - Intergenic
1202363978 Y:24142174-24142196 AAATTACAGGATATAAAAGGTGG + Intergenic
1202382574 Y:24288626-24288648 AAAAATGAGGATATCTAAGGAGG + Intergenic
1202488210 Y:25381499-25381521 AAAAATGAGGATATCTAAGGAGG - Intergenic
1202506802 Y:25527948-25527970 AAATTACAGGATATAAAAGGTGG - Intergenic