ID: 908436344

View in Genome Browser
Species Human (GRCh38)
Location 1:64110552-64110574
Sequence AAAAACAGGATAACAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 996
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 917}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908436337_908436344 12 Left 908436337 1:64110517-64110539 CCATCCTCATCTTTCTTCTGCTT No data
Right 908436344 1:64110552-64110574 AAAAACAGGATAACAAAGGAGGG 0: 1
1: 0
2: 4
3: 74
4: 917
908436338_908436344 8 Left 908436338 1:64110521-64110543 CCTCATCTTTCTTCTGCTTGCTT 0: 1
1: 1
2: 2
3: 99
4: 1074
Right 908436344 1:64110552-64110574 AAAAACAGGATAACAAAGGAGGG 0: 1
1: 0
2: 4
3: 74
4: 917
908436336_908436344 13 Left 908436336 1:64110516-64110538 CCCATCCTCATCTTTCTTCTGCT 0: 1
1: 0
2: 3
3: 58
4: 758
Right 908436344 1:64110552-64110574 AAAAACAGGATAACAAAGGAGGG 0: 1
1: 0
2: 4
3: 74
4: 917
908436335_908436344 23 Left 908436335 1:64110506-64110528 CCATCTAATTCCCATCCTCATCT 0: 1
1: 0
2: 2
3: 37
4: 384
Right 908436344 1:64110552-64110574 AAAAACAGGATAACAAAGGAGGG 0: 1
1: 0
2: 4
3: 74
4: 917

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908436344 Original CRISPR AAAAACAGGATAACAAAGGA GGG Intronic
900012120 1:123618-123640 AAAATGAGGATATCTAAGGAGGG - Intergenic
900042180 1:479629-479651 AAAATGAGGATATCTAAGGAGGG - Intergenic
900063620 1:714625-714647 AAAATGAGGATATCTAAGGAGGG - Intergenic
901479183 1:9512603-9512625 AAACAGAGGAGAACAAAGGAAGG - Intergenic
901586546 1:10299127-10299149 AAAAAAAGAATAACTAAGCACGG + Intronic
901852541 1:12025023-12025045 AAAAACAAAAAAAAAAAGGAAGG - Intronic
902067308 1:13699351-13699373 AAAAACAGGATACTAAGGGCAGG - Intergenic
902432129 1:16371434-16371456 AAAAAAAGGAAAAAAAAGGAAGG - Intronic
902908645 1:19578621-19578643 AAAAAAAGGATAAAAGAGGCCGG - Intergenic
902959414 1:19951932-19951954 AAAAAAAGAAGAAGAAAGGAAGG + Intergenic
903094872 1:20961646-20961668 TGAAACAGCATAACAAAGCAAGG + Intronic
904355343 1:29935078-29935100 AAAAGGAGGACAACAGAGGAAGG + Intergenic
904812354 1:33171665-33171687 AAGAACAGGATAAACATGGAGGG + Intronic
905382239 1:37571117-37571139 AAAAACAGAATCACAGAGTAAGG + Intronic
906184229 1:43849132-43849154 AAACAGAAGAAAACAAAGGATGG - Intronic
907626810 1:56038630-56038652 AAACAGAGGATAAAAGAGGAGGG - Intergenic
907648400 1:56267631-56267653 AAAAATAGAATAAAAATGGAGGG + Intergenic
907968501 1:59357181-59357203 AAATACAGGATAATAAGGAAAGG - Intronic
908048321 1:60197435-60197457 AAAAACAGGATATCCAAGGAAGG - Intergenic
908226103 1:62057267-62057289 ACAAAGAAGAAAACAAAGGAAGG + Intronic
908246210 1:62229400-62229422 AAACACAGAAAAACAGAGGAGGG + Intergenic
908436344 1:64110552-64110574 AAAAACAGGATAACAAAGGAGGG + Intronic
908487351 1:64607788-64607810 AAAAACAGAATCACTAAGAAGGG - Intronic
908562756 1:65323586-65323608 AAAGAAAAGAAAACAAAGGAAGG - Intronic
908971896 1:69845536-69845558 GTAAACTAGATAACAAAGGAAGG - Intronic
909142488 1:71886458-71886480 AAAAAAAAAAAAACAAAGGAAGG + Intronic
909389454 1:75102218-75102240 AAAAACAGGAAACCAAATTAGGG - Intergenic
909443421 1:75723049-75723071 AGACAGAGGAGAACAAAGGAAGG - Intergenic
909526570 1:76630240-76630262 ACAAAAAGTATCACAAAGGATGG + Exonic
909606235 1:77511398-77511420 CCAAACAGGATAAAGAAGGATGG + Intronic
909652924 1:77996059-77996081 TAAAAGAGGGTAACAAAGAAGGG + Intronic
909676746 1:78246926-78246948 AAAAACAGGATACTAGAGGCTGG - Intergenic
909737704 1:78985314-78985336 AAAAGCAGGCTTACAAAGTAAGG + Intronic
909891988 1:81018789-81018811 AAAAAGAGGAAAAAACAGGAGGG + Intergenic
910267796 1:85358290-85358312 AAATACAGGAAAACACAAGAAGG - Intronic
910945363 1:92585835-92585857 AAAAACAGGTTAAAAAACAAAGG - Intronic
911526550 1:98994288-98994310 AAAAAGAGGAGAGTAAAGGAGGG - Intronic
911632137 1:100195125-100195147 AAAAATAGGATAAGAAATTAAGG - Exonic
911635348 1:100229160-100229182 AAAAAAAGGAAAAAAAAGAAAGG - Intronic
912225343 1:107727014-107727036 AAAAACATCATAACAACGGTTGG + Intronic
912821475 1:112871247-112871269 GGAAACAGGATAACAAAACAGGG + Intergenic
913075265 1:115336681-115336703 AAACACAGGATAAGAAGGGCTGG + Intronic
913301359 1:117373257-117373279 AAAAACAGGATAGAAAAAAAAGG - Intronic
913488559 1:119356800-119356822 AGGCAGAGGATAACAAAGGAAGG + Intergenic
913944261 1:125142882-125142904 AAAAAGAGGAAAAGAAGGGAGGG + Intergenic
914385753 1:147168300-147168322 AAAAAAATGAAAACAAAGTATGG + Intronic
914902516 1:151718556-151718578 AAAAACAGGCTAAGGAAGGATGG - Intronic
915226784 1:154417571-154417593 AAAGAAAGGATATCTAAGGAGGG - Intronic
915237121 1:154492069-154492091 AAAAAGAGGGCAACAAATGAGGG + Intronic
915542893 1:156579924-156579946 AAAAAAAGGATAAAATGGGAGGG + Intronic
916040117 1:160954488-160954510 AACGAGAGGATGACAAAGGAAGG - Intronic
916589072 1:166172903-166172925 AGAAACAGGAGAAGGAAGGAAGG - Intergenic
916736736 1:167614186-167614208 AAAAAAAAAACAACAAAGGAAGG - Intergenic
917077867 1:171224519-171224541 AAGCAGAGGAGAACAAAGGAAGG - Intergenic
917845004 1:179013372-179013394 AAAAAAAGAATAAAAAAGAATGG + Intergenic
917911008 1:179646268-179646290 AAAAACAGGTTAGAAGAGGAGGG - Intronic
918366552 1:183814103-183814125 AAAAACAGAGGAAGAAAGGAAGG + Intronic
918687554 1:187437266-187437288 AAAAACAGTATAATAATTGAAGG + Intergenic
918940500 1:190989831-190989853 AAAAAAAAAATAACAAAGTATGG + Intergenic
918956811 1:191218421-191218443 AAAGACAGGAAGATAAAGGAAGG - Intergenic
919574765 1:199294254-199294276 AAAAACAAGATTTCAAAGCATGG - Intergenic
920222816 1:204416712-204416734 AAAAAAAGGAAAGAAAAGGAAGG + Intergenic
920557447 1:206914423-206914445 AAAAAAAAGAAAAGAAAGGAAGG - Intronic
920787816 1:209059469-209059491 AAAAATGGGAGAACACAGGAGGG + Intergenic
920855923 1:209661649-209661671 CAAAAGAGGAAAACAAAGCAGGG + Intergenic
921273611 1:213494661-213494683 GATAACAGGATAACAGAGAATGG + Intergenic
921369575 1:214407744-214407766 AAAAACAAGAAAGCAAAGCAAGG - Intronic
921495866 1:215840828-215840850 TAAAAAAGGCTAACACAGGAAGG - Intronic
922260547 1:223940115-223940137 AAAATGAGGATATCTAAGGAGGG - Intergenic
922415835 1:225422343-225422365 TAGAAGAGGATAACAAAGGCAGG + Intronic
922435220 1:225598661-225598683 GAAAACAGGACAAAAAGGGATGG + Intronic
922736524 1:227985615-227985637 AAAATGAGGATATCTAAGGAGGG + Intergenic
923185708 1:231571246-231571268 AAAAACAGAGTAAAAAGGGAGGG - Intronic
923348795 1:233083288-233083310 AAAAAGAGGGTGGCAAAGGAAGG + Intronic
923388689 1:233491946-233491968 AAAAACAGAGAAAGAAAGGAAGG + Intergenic
924341723 1:243042309-243042331 AAAATGAGGATATCTAAGGAGGG - Intergenic
924535425 1:244931667-244931689 AAAAAAAGAAGAAGAAAGGAAGG - Intergenic
924627845 1:245710600-245710622 AGAGACAGGATCAAAAAGGATGG - Intergenic
1062849396 10:731695-731717 AAAAAAAGGAAAGGAAAGGAGGG + Intergenic
1063707044 10:8440677-8440699 AATAAGAGGATAACAAAGAATGG - Intergenic
1063713249 10:8501481-8501503 AAAAACAGGAAAACCAAACAAGG + Intergenic
1064203826 10:13306074-13306096 AGAAACAGGGAAACATAGGAGGG + Intergenic
1064241126 10:13630232-13630254 AAAATAAGGAAAACAAAGGTTGG - Intronic
1064734096 10:18362912-18362934 AAAAACAGAAAAACAAAAGAAGG + Intronic
1065165262 10:22970126-22970148 AAACACAGGATCACCCAGGAAGG + Intronic
1066014098 10:31220866-31220888 AAAATCTGGAGAATAAAGGATGG + Intergenic
1066476123 10:35748962-35748984 AAAAACAGGAAATCATGGGAGGG + Intergenic
1066666048 10:37783618-37783640 AAAAACAGGTCAAGAATGGATGG + Intronic
1066734756 10:38463238-38463260 AAAATGAGGATATCTAAGGAGGG + Intergenic
1068164584 10:53312352-53312374 CAAAACAGGATGACAAAGTAGGG - Intergenic
1068218450 10:54012242-54012264 AAAAAAAGAATAAAAAAGAATGG + Intronic
1068336206 10:55634967-55634989 AAAAAAATGGTAACACAGGATGG - Intergenic
1068440439 10:57048435-57048457 AAAAAAAGGATTAAAAAGAATGG + Intergenic
1069011538 10:63379022-63379044 AAAGACAGGATAGGAAGGGAGGG - Intronic
1069178943 10:65332157-65332179 AAAAACAGCATCACATAGGATGG - Intergenic
1069213635 10:65792473-65792495 AAGCAGAGGAGAACAAAGGAAGG + Intergenic
1069381078 10:67843641-67843663 AAAAAAAGGAAAAAAAAGAAAGG - Intergenic
1070005095 10:72416198-72416220 AAAAACAGGAAAATAATAGAGGG + Intronic
1070016093 10:72532976-72532998 AAAGGCAGGATCACAAAAGAGGG - Intronic
1070664853 10:78335903-78335925 AGAAACAGCAAAACAAAGGAAGG + Intergenic
1070851334 10:79564147-79564169 AAAACCAGGAGAATGAAGGATGG - Intergenic
1071316637 10:84407399-84407421 AAATATAGCATAAAAAAGGAAGG - Intronic
1071688654 10:87791411-87791433 AAAAAAATGATAAAAAGGGAAGG + Intronic
1071770405 10:88722851-88722873 AAAAACAATTTAAAAAAGGATGG - Intergenic
1072682866 10:97519195-97519217 AGAGAAAGGAGAACAAAGGATGG - Intronic
1072897825 10:99382004-99382026 AAAAACACAATAACAACAGAAGG - Intronic
1074444047 10:113503820-113503842 AAAAACAGGTCAAAAAAGGAAGG - Intergenic
1074491018 10:113939566-113939588 AAATACAAGATACCAAGGGAAGG - Intergenic
1074494511 10:113968139-113968161 GAACACAGGAGCACAAAGGAAGG - Intergenic
1074909977 10:117899674-117899696 AAAAAAAGAAAAAAAAAGGAAGG + Intergenic
1075010007 10:118859659-118859681 AAAAAGAGGAAAAGATAGGAGGG - Intergenic
1075049801 10:119175113-119175135 AAAAAGAGGAAGACAAAGTAGGG + Intronic
1075075040 10:119344962-119344984 AAAAAAAGAAAAAGAAAGGAAGG - Intronic
1076117958 10:127913759-127913781 ATAAACTGGAGAAGAAAGGAAGG - Intronic
1076565962 10:131399493-131399515 AGGTACAGGAGAACAAAGGAAGG + Intergenic
1076968451 11:115824-115846 AAAATAAGGATATCTAAGGAGGG - Intergenic
1077832880 11:5894428-5894450 AAAAATAGGAAAAAAAAGAATGG + Intronic
1078092413 11:8273442-8273464 TAAAACACCATGACAAAGGAGGG + Intergenic
1078479880 11:11666328-11666350 AAAAGCTGGATAAAGAAGGAAGG + Intergenic
1078537715 11:12188036-12188058 AAAAGCTGGAGAAAAAAGGAGGG - Intronic
1079442301 11:20527131-20527153 AAAGAAAGGAAAAAAAAGGATGG + Intergenic
1079512602 11:21228753-21228775 AAAAAGAGGAGAGGAAAGGAGGG - Intronic
1079955407 11:26856835-26856857 AAAAACAAGAGAAGGAAGGAAGG + Intergenic
1079956047 11:26866055-26866077 AAAAACAGAAAAAGGAAGGAAGG + Intergenic
1080220971 11:29903505-29903527 AAAAAAAAGATAACAAATGTTGG + Intergenic
1080237273 11:30085243-30085265 AAAAACAAGAAAAAGAAGGAAGG + Intergenic
1080702103 11:34652729-34652751 AAAAACAGAAAAAAAGAGGAAGG - Intronic
1080730352 11:34944767-34944789 AAAAACAGAATAAAAAACAAGGG - Intronic
1080736229 11:35016864-35016886 AAAAAGATGACAACAAAGTAGGG + Intronic
1080741693 11:35070624-35070646 AGAAAGAGGATCAAAAAGGACGG + Intergenic
1080814015 11:35736482-35736504 ACAAACAAAATAACAAAGAAGGG - Intronic
1080928773 11:36785442-36785464 TTAGACAGGGTAACAAAGGAAGG + Intergenic
1080990052 11:37521735-37521757 AAAGACAGAATAACAAATGCTGG + Intergenic
1081321858 11:41701205-41701227 AAAAATAGGATAAAAATAGAAGG + Intergenic
1082922390 11:58509705-58509727 AAAAACAAGTTAAAAAAGGCTGG - Intergenic
1083082303 11:60106895-60106917 AAAAAAAGGAGAAAAAAGGAAGG - Intergenic
1083188091 11:61029497-61029519 AAAAAAAGGAAAAAAAAAGAGGG + Intergenic
1083283815 11:61644811-61644833 CAAAACAGGATAAAAAAGCAGGG - Intergenic
1083914217 11:65729565-65729587 AAAAAGAGGTTAAAAAAGCAAGG - Intergenic
1084074335 11:66761407-66761429 AAAAAAATGATAATAAATGAGGG + Intronic
1084451277 11:69240275-69240297 AAAAAAAGGAAAACAAAATATGG + Intergenic
1084481298 11:69422056-69422078 AAAAAAAAGAAAAGAAAGGAAGG - Intergenic
1085060171 11:73438620-73438642 AATAACAGGAAAACATTGGAGGG + Intronic
1085089387 11:73697307-73697329 AAAAACAGAAAAATAAAGTAGGG - Intronic
1085208941 11:74756963-74756985 AAAAACTGCATAATAAAGAACGG + Intronic
1085231385 11:74974096-74974118 AAAAAAAGTATTACAAAGTAAGG - Intronic
1085262462 11:75214998-75215020 AAAAACAGGCTCAGAAAGAAAGG - Intergenic
1085488859 11:76894794-76894816 GGAAACAGTATAACAAAAGAAGG + Intronic
1085555272 11:77413699-77413721 AAAAAAAGGAAAGAAAAGGAAGG + Intronic
1085639267 11:78181827-78181849 ATAAACAGGAAAAAAAATGAAGG + Intronic
1086761151 11:90633350-90633372 AAATAGAGGATAACAAATGTTGG - Intergenic
1086920916 11:92585811-92585833 AAAAACAGGAAAGCAAACAAAGG - Intronic
1086966001 11:93028816-93028838 AAAGAAAGGAAAAGAAAGGAGGG - Intergenic
1087064002 11:94010472-94010494 AAAAACAGGACAACTCAGGGTGG - Intergenic
1087081830 11:94178343-94178365 AAAAACAAGAGAACAAATCATGG - Intronic
1088019214 11:105099349-105099371 AAAAACAGCATTACCTAGGAAGG + Exonic
1088917099 11:114235776-114235798 AAAAAAAGGAGAAGGAAGGAAGG - Intronic
1089020033 11:115204248-115204270 AAAATGTGGATAAGAAAGGATGG - Intronic
1089074395 11:115726808-115726830 GAAAATAGAAGAACAAAGGAAGG + Intergenic
1089783819 11:120893878-120893900 ACAAACAGGATGACAGAGAAAGG - Intronic
1090410975 11:126509509-126509531 AAAAAAAGGAAAAAAGAGGATGG - Intronic
1090414060 11:126528696-126528718 CAAAACAGGGTAGAAAAGGAGGG + Intronic
1090790508 11:130089506-130089528 AGAAACAGGATTACAATGTAAGG - Intronic
1090818851 11:130322510-130322532 AAGCAGAGGAGAACAAAGGAAGG + Intergenic
1091141235 11:133236775-133236797 AAGTAGAGGAGAACAAAGGAAGG - Intronic
1091940387 12:4474887-4474909 AAAGATAGGATAACAAATGTTGG + Intergenic
1091992968 12:4971788-4971810 CAAAACAGGATAATACAGTATGG - Intergenic
1092049536 12:5458131-5458153 AAAAACAGCAAAACCCAGGATGG - Intronic
1092086242 12:5764702-5764724 AAAAGCAGGAGAACAGGGGAGGG - Intronic
1092290825 12:7158617-7158639 GGAAACAGGACAAGAAAGGAAGG - Exonic
1092376627 12:7960991-7961013 AGAAACAGAAGAACAAAGAAGGG - Intergenic
1092511810 12:9164585-9164607 AGAAATAGGAGAAGAAAGGAAGG - Intronic
1092612610 12:10188186-10188208 GAAAAAAGGATAACCAAGGCTGG + Intronic
1092971171 12:13696740-13696762 GAAAACAGGATGAAAGAGGATGG - Intronic
1093144642 12:15550833-15550855 AAGAACAGGATATCAAAGGCAGG - Intronic
1093473059 12:19525480-19525502 AAAAAAAGGAAAGGAAAGGAGGG - Intronic
1093642700 12:21545703-21545725 TAAAATAAAATAACAAAGGAGGG + Intronic
1093725891 12:22508098-22508120 AAAAGCATGATCACAAAGCACGG + Intronic
1094681468 12:32671096-32671118 AAAAACAGAAAAACAGAGAAGGG + Intergenic
1094727895 12:33141476-33141498 AAAAAGAGGTTAATAAAGGAAGG - Intergenic
1095193761 12:39288373-39288395 AAAAAGAAGATAGGAAAGGAAGG + Intergenic
1095371769 12:41476314-41476336 AGAAACAGCATAACAAACTAGGG + Intronic
1095819233 12:46459358-46459380 AATACAAGCATAACAAAGGAAGG - Intergenic
1096173667 12:49495954-49495976 AAAAAATGGTTAACAAAGAAAGG - Intronic
1096988141 12:55775573-55775595 AAAAAAAGAGTAGCAAAGGAAGG + Intronic
1097202265 12:57289272-57289294 AAAAAGAGGCTGACAAAGGCAGG + Intronic
1097481428 12:60131019-60131041 AAATCCAGGATAACAAAAGAAGG - Intergenic
1097691058 12:62735050-62735072 AAAAACAAAAAAACAACGGAAGG + Intronic
1097717907 12:62985961-62985983 AAAAAAAGCAAAACAAAGGCAGG - Intergenic
1097739548 12:63224216-63224238 AAAAACAATATATCAAGGGAAGG + Intergenic
1098155370 12:67592401-67592423 AAAAAGAGAAAAAGAAAGGAAGG + Intergenic
1098194237 12:67983030-67983052 AAAAACAGTATGATGAAGGAAGG - Intergenic
1098934908 12:76467448-76467470 AAAATTATGTTAACAAAGGAAGG + Intronic
1099390769 12:82076078-82076100 GAAAAGAGGATACCAGAGGATGG - Intergenic
1099496364 12:83351723-83351745 AAAGAAAGAAAAACAAAGGAGGG - Intergenic
1099753568 12:86809536-86809558 AAAAATAGGATACCAAATGCAGG - Intronic
1099804816 12:87505476-87505498 AAAAACAGAAAAAGAAAAGATGG + Intergenic
1100180426 12:92079720-92079742 ACAAACACCATAACACAGGAAGG + Intronic
1100195938 12:92244483-92244505 AAAAACAGGATGACAAAAGAAGG + Intergenic
1100346165 12:93733732-93733754 AAAAAAAAAAAAACAAAGGATGG - Intronic
1100353426 12:93806474-93806496 AAAAAAAAGAAAAAAAAGGATGG + Intronic
1100456750 12:94759325-94759347 AAAAAAATGAAAAGAAAGGAAGG - Intergenic
1100596577 12:96077443-96077465 AAACCCAGGAGAACAAAGGTGGG - Intergenic
1100884744 12:99057467-99057489 TAAAACAAGATAAAGAAGGAAGG - Intronic
1100951201 12:99852568-99852590 AAAAACAGGAGAAAAAATGGCGG + Intronic
1101245272 12:102878677-102878699 GAAAACAAGATAAGGAAGGAAGG + Intronic
1101269194 12:103125128-103125150 AAAAACAGAATATGAAAGAATGG - Intergenic
1102399911 12:112619694-112619716 AAAAAGACAATAACAAAGGTTGG - Intronic
1102458598 12:113086641-113086663 GAAAAAAGGAAAAAAAAGGAAGG - Intronic
1102709132 12:114909912-114909934 AGGAAGAGGATAACAAAGAAAGG - Intergenic
1103921402 12:124401218-124401240 AAAAAAAGAAAAAGAAAGGATGG + Intronic
1104204441 12:126624449-126624471 AAAAACAGGAAAACAAAACATGG - Intergenic
1104435985 12:128756982-128757004 AAAAAAAGGAGAAGGAAGGAAGG + Intergenic
1105249587 13:18685854-18685876 AAAAAAAGGATAACTGAAGAGGG - Intergenic
1105644372 13:22301673-22301695 AACAATAGGAACACAAAGGAAGG - Intergenic
1105759401 13:23499607-23499629 AGAAACAGAAGAAGAAAGGATGG + Intergenic
1105780939 13:23704859-23704881 AAAAACAGGAAGAAGAAGGAAGG - Intergenic
1106071245 13:26413223-26413245 AAAAACATGTTTACATAGGAAGG + Intergenic
1106401645 13:29436801-29436823 AAAAGCAAGAAAAGAAAGGAAGG - Intronic
1106883256 13:34155007-34155029 AAAAAAAGGAAAAAAAAGAAAGG + Intergenic
1107030055 13:35841525-35841547 AAAAAAAGGAAAAAAAAGTAGGG + Intronic
1107220959 13:37979491-37979513 AAAAACAGCATAAGAAATAAAGG + Intergenic
1107239922 13:38220299-38220321 AAAAACAAGATAACAATAAATGG - Intergenic
1107466669 13:40657305-40657327 AAAAAAAAGAAAAAAAAGGATGG - Intronic
1107608565 13:42088460-42088482 AATAGCAGTAGAACAAAGGAGGG + Intronic
1107997760 13:45877769-45877791 AAAAACAGGTTTCCTAAGGAAGG - Intergenic
1108221253 13:48235321-48235343 AAAAAATGGAAAACAAAGCACGG - Intronic
1108426161 13:50302983-50303005 AAAAAAAGAAAAAAAAAGGATGG + Intronic
1108828328 13:54444107-54444129 AAAATGATGATCACAAAGGATGG + Intergenic
1109172317 13:59112199-59112221 AAAAAGAGAATAAGAAAGGATGG + Intergenic
1109357403 13:61248090-61248112 AAAAAAAAGAAAAAAAAGGAGGG - Intergenic
1109473057 13:62836008-62836030 AAAAATAAAATAAAAAAGGAAGG - Intergenic
1109657915 13:65419041-65419063 AAAAACAGAAAAAGGAAGGAAGG - Intergenic
1109755547 13:66754426-66754448 AAAAAAAGGAAAAAAAAAGAGGG + Intronic
1110019211 13:70448162-70448184 AAAAAAAAGATCACAAATGAAGG + Intergenic
1110191718 13:72737645-72737667 AAAAAAAGGATGAAAAGGGAAGG - Intronic
1110194348 13:72769481-72769503 AAAAAAAGGAAAAAAAATGATGG - Intronic
1110324776 13:74201399-74201421 AAGATCAGGATGAGAAAGGAAGG - Intergenic
1111024460 13:82500939-82500961 AAGAACAGAATAGCAAAGTATGG + Intergenic
1111055429 13:82943133-82943155 AAACATAAGATAACATAGGATGG + Intergenic
1111317206 13:86578200-86578222 AGAAACAGAAAAAAAAAGGAGGG - Intergenic
1111848812 13:93545929-93545951 ATAATCAGGATATCAAAAGAGGG - Intronic
1111910962 13:94311635-94311657 AAAAACATGATTTCAAAGAAGGG - Intronic
1112148908 13:96734400-96734422 AAAGTCTGGATAACAAAGGTGGG - Intronic
1112696661 13:101956870-101956892 AAAAAAACAAAAACAAAGGAAGG - Intronic
1112944396 13:104909357-104909379 AAAAAGAAGACAAGAAAGGAAGG - Intergenic
1113115952 13:106875139-106875161 AAAGACAGGCAAACAAGGGATGG + Intergenic
1113355009 13:109570699-109570721 AAAAATAGAAAAAGAAAGGATGG - Intergenic
1113833878 13:113316103-113316125 AAAAACAAAAAAACAAAGTAGGG + Intronic
1114274971 14:21134789-21134811 ATAAACAGGACAGGAAAGGAAGG - Intergenic
1114331481 14:21641566-21641588 AAAGAAAGAATAAAAAAGGAAGG - Intergenic
1114407431 14:22469879-22469901 AAGAAAAGAAAAACAAAGGAAGG + Intergenic
1115137168 14:30124535-30124557 ACAAGCAGGTTAACAAAGAAGGG - Intronic
1115838348 14:37435436-37435458 AAAAAAATAATAATAAAGGAGGG - Intronic
1115986728 14:39109874-39109896 AAAAGCCATATAACAAAGGAGGG + Intergenic
1116380374 14:44260643-44260665 AAACACAGGATACTAGAGGATGG + Intergenic
1116543839 14:46136784-46136806 GAAAAAAGGGTAATAAAGGAAGG + Intergenic
1116925871 14:50636423-50636445 ACAAACAGGAAAACTAAAGAAGG + Intronic
1117454762 14:55885980-55886002 AAGAATAGGATACGAAAGGATGG + Intergenic
1117473578 14:56071223-56071245 AAAAACAGAAGGACAAAGAAGGG - Intergenic
1117918323 14:60701759-60701781 AAAAAAAGGAAAGGAAAGGAAGG - Intergenic
1117943893 14:60997692-60997714 AGAAACAGGTTAACAAATGGTGG + Intronic
1117965306 14:61201717-61201739 AAAAACAGGTTAACAAAAGTTGG + Intronic
1118359673 14:65045370-65045392 AGAAACAGGAAAAAAAAGTATGG - Intronic
1118408093 14:65447077-65447099 AAAAACATGAAAATAAAGAAAGG - Intronic
1118577184 14:67254535-67254557 AAAAATCTGATAAGAAAGGAAGG - Intronic
1118637277 14:67759260-67759282 AAAAAAAGGAAAACACAGAAAGG + Intronic
1119132328 14:72185527-72185549 AATAACAGTATGACAAATGAAGG + Intronic
1119190448 14:72678429-72678451 ATAAACAGGATCACCCAGGATGG - Intronic
1119843847 14:77813750-77813772 AAAAACAGGAAAACAAAGAGAGG - Intronic
1120152225 14:81049328-81049350 CAAAACTGCATAGCAAAGGAAGG + Intronic
1120200710 14:81534983-81535005 AAAAACAAAAAAAAAAAGGAAGG - Intergenic
1120499757 14:85280763-85280785 AAAAACAGGAAAAAAAAATATGG + Intergenic
1120576184 14:86183796-86183818 AAATACAGTCTAACAGAGGAAGG + Intergenic
1121854475 14:97254248-97254270 AAATACAAGATAAGAAAGGAGGG - Intergenic
1121875270 14:97445687-97445709 AAAAAAAGAAAAAGAAAGGAGGG - Intergenic
1121882923 14:97516459-97516481 AAATTCAGGAAGACAAAGGAAGG - Intergenic
1122155618 14:99748413-99748435 AAAAAAAAGATAACAAAGCCAGG - Intronic
1122426995 14:101616067-101616089 AAAAAAAGGAAAAGAAAAGAAGG + Intergenic
1122510826 14:102266302-102266324 AAAAACAAAAAAAAAAAGGAGGG - Intronic
1122514152 14:102294628-102294650 AAAAAAAGAAAATCAAAGGAGGG + Intronic
1122758818 14:104004960-104004982 AAAAGAAGGAGGACAAAGGAAGG - Intronic
1122963109 14:105108053-105108075 ACAAACAAAAAAACAAAGGAAGG + Intergenic
1123709620 15:22977862-22977884 AAAGAAAAGAAAACAAAGGAGGG + Intronic
1125243102 15:37599636-37599658 AAAAAAAGAATAAAAAAAGAAGG - Intergenic
1125645362 15:41267941-41267963 AAAAAAAGCATAAAAAAGGAAGG + Intronic
1125767131 15:42143459-42143481 ACAAAGAGGAGACCAAAGGAAGG + Intronic
1126207107 15:46058228-46058250 CAAAACATGAACACAAAGGAAGG + Intergenic
1126318059 15:47392006-47392028 AAAAACTGGATAGAGAAGGATGG - Intronic
1126760501 15:51965651-51965673 AAAAACAGGGTAATAAAGATGGG + Intronic
1127418189 15:58778108-58778130 AAAAAAAGTATAACCAAGTAGGG - Intronic
1127453450 15:59137976-59137998 AAAAACAGCTTGACAAGGGAGGG + Intronic
1127530050 15:59834864-59834886 AAAAACAGGAAAACAGAAAAAGG - Intergenic
1127758147 15:62112895-62112917 GAAAACATGAAAGCAAAGGAAGG + Intergenic
1127871621 15:63078825-63078847 AAAAAGAGGAGAACAAATTATGG - Intergenic
1127954266 15:63839149-63839171 AGAAGCAGGATATCAAAGAAGGG + Intergenic
1128059932 15:64728865-64728887 AAGAAGAAGAAAACAAAGGAGGG + Intergenic
1129529756 15:76255488-76255510 AAAATCAGGAAAACAAATCATGG + Intronic
1129875909 15:78975500-78975522 AAAAAAAGAAAAAGAAAGGAAGG - Intronic
1130266031 15:82404429-82404451 AAATACAGGATATAAAAGGTGGG + Intergenic
1130505984 15:84542445-84542467 AAATACAGGATATAAAAGGTGGG - Intergenic
1131627797 15:94142159-94142181 AAAAACTGAAAAAGAAAGGAAGG - Intergenic
1131808934 15:96152539-96152561 AAAAACAGAAAAAAAAAAGACGG - Intergenic
1132011915 15:98283716-98283738 AAAACAAGGACAACATAGGAAGG - Intergenic
1132755912 16:1485332-1485354 AAAAAAAAGATAAGAAAGAAAGG + Intergenic
1132805252 16:1772242-1772264 CAAAACAGGAAGACAAAGGAAGG - Exonic
1133117491 16:3586023-3586045 AAAAACAGAATAACAAGTGTTGG + Intronic
1133262896 16:4563546-4563568 AAAAAAAGGTTAACAGAGGGTGG - Intronic
1134035401 16:11026587-11026609 AAAAACAGCAGAACAATAGAGGG - Intronic
1134213142 16:12294831-12294853 GAAAACAGGCTAATACAGGAAGG - Intronic
1134438084 16:14280100-14280122 AAAAAGAGGAGGACGAAGGAGGG + Intergenic
1135189779 16:20345380-20345402 AAAAAAAAGAAAAGAAAGGAAGG - Intronic
1135246962 16:20865232-20865254 AAAAATAGAAAAACAAAAGAAGG + Intronic
1135278188 16:21131355-21131377 AGAAACAGGGTCACAGAGGAAGG + Intronic
1135512969 16:23103951-23103973 CAAAACAGAAAAACAAAAGATGG + Intronic
1135542590 16:23343457-23343479 AAAAAAAGGAAAAGAAAGAAAGG + Intronic
1135813629 16:25611940-25611962 AAAAAAAGGAAAAGAAAAGAGGG - Intergenic
1135910608 16:26557516-26557538 AAAAAAAGGAAAAGGAAGGAAGG - Intergenic
1135989053 16:27206222-27206244 ACAAACAGGCTTCCAAAGGAGGG - Intronic
1136170059 16:28483699-28483721 AAAAAAAAGAAAAGAAAGGAAGG - Intronic
1136614173 16:31386211-31386233 AAAAAGAGAAAAAAAAAGGAGGG + Intergenic
1138320600 16:56107963-56107985 ATTAACAGGATAAGAAAGCAGGG + Intergenic
1139155050 16:64431485-64431507 AAAAAAAAGGTCACAAAGGAAGG - Intergenic
1140045407 16:71437361-71437383 AAAAAAAGGAAAAGAAAGGGAGG + Intergenic
1140162329 16:72510624-72510646 AAAAACATTATTACAAAAGAAGG + Intergenic
1140828081 16:78726220-78726242 AAAAAAAGAAGAAAAAAGGAAGG - Intronic
1142279336 16:89139574-89139596 AAAAACAGAAAAAAAAAGGAGGG - Intronic
1142452225 16:90183296-90183318 AAAATGAGGATATCTAAGGAGGG + Intergenic
1142670795 17:1486506-1486528 AAAAACAGAAAAAAAAAGGAGGG - Intronic
1142919865 17:3175207-3175229 AAAAAAAGGAAAAGATAGGAAGG + Intergenic
1143229120 17:5336705-5336727 AACAACAGGAAAAAAAAGGAGGG - Intronic
1143439486 17:6958022-6958044 CATAAAAGGATACCAAAGGAAGG + Intronic
1143801296 17:9384114-9384136 AAAAAAAAAATAACAAATGAGGG - Intronic
1144671302 17:17134106-17134128 AAAAACAGGATTCTTAAGGAAGG - Intronic
1145756805 17:27398012-27398034 AAAAAAAAGAAAAGAAAGGATGG + Intergenic
1146107921 17:30059515-30059537 ACAAACAGGATAATAAAGCACGG - Intronic
1146619306 17:34385199-34385221 AAAAAAGGGAAAAAAAAGGAAGG - Intergenic
1146645913 17:34577658-34577680 AGAAACTGAATCACAAAGGAAGG + Intronic
1146974485 17:37099184-37099206 AAACACAGGTTAACAGAGGAGGG + Intronic
1147407288 17:40221144-40221166 AATAACAGCATGAAAAAGGACGG - Intronic
1147743569 17:42682014-42682036 AAAAAAAGAAGAAGAAAGGAAGG + Intronic
1148262692 17:46197115-46197137 AAAAAAAGAAAAAGAAAGGAAGG + Intronic
1149037477 17:52151285-52151307 AAAAACAAAATATCAAAGTATGG - Intronic
1149067649 17:52499317-52499339 AAAAACAAGAGAAAAAAAGACGG - Intergenic
1149123791 17:53203378-53203400 AAAAAGTGGCTAACAAAGTATGG + Intergenic
1149763441 17:59253900-59253922 AAATACAGGTTTCCAAAGGAAGG + Intronic
1149785904 17:59434777-59434799 AAAAAAAGAAAAAGAAAGGAAGG - Intergenic
1149969270 17:61200130-61200152 ATAAAGAGGATAAGAAATGAAGG - Intronic
1150100703 17:62421145-62421167 AAAAAAAGGAGAAGAAAGGCCGG + Intergenic
1150256173 17:63747226-63747248 CAAACCAGAATAACAAAGGCTGG - Intronic
1151366182 17:73617794-73617816 AAAAACAGGACATCATAAGAGGG + Intronic
1151688463 17:75664479-75664501 AACAAAAAAATAACAAAGGAGGG + Intronic
1152518747 17:80842687-80842709 TAAAACAGGATACCAAAAGCCGG - Intronic
1153177032 18:2387379-2387401 AAAAATAGTAGAACAAAGGAAGG + Intergenic
1154291554 18:13112532-13112554 AAACACAACATAACACAGGAGGG - Intronic
1154439243 18:14373037-14373059 AAAAAAAGGATAACTGAAGAGGG + Intergenic
1154960610 18:21304967-21304989 AAAAAAAGATTAACACAGGAGGG - Intronic
1155123939 18:22852190-22852212 AAAAAAAGGGTAACAGAGGAAGG - Intronic
1155261255 18:24044605-24044627 GAACACAGGAGAACAAAGAAAGG + Intronic
1155825074 18:30431163-30431185 AAAACCAGGACTACAGAGGAAGG - Intergenic
1156193105 18:34742718-34742740 AAAAACAGGGTAATATAGTATGG + Intronic
1156196141 18:34776225-34776247 AGGAGCAGGATAACAAAGGTGGG + Intronic
1156713819 18:39982101-39982123 GAAAACACGATAACAAATAATGG + Intergenic
1157014134 18:43689525-43689547 ATAAATAGGATAACATAGGAGGG + Intergenic
1157369024 18:47093097-47093119 AAAACCTGGAGAACAAAGAAAGG - Intronic
1158007916 18:52694419-52694441 AAAAAAATAATAATAAAGGAAGG + Intronic
1158099418 18:53812521-53812543 AAAAATAGGACAAATAAGGAAGG - Intergenic
1158426266 18:57342217-57342239 CAAGGCAGGATAACAAAGAAGGG + Intergenic
1158584806 18:58722603-58722625 AAAAACAAGATAACTAAAAAAGG - Intronic
1158904878 18:62002105-62002127 GAAGACAGGAAGACAAAGGAAGG - Intergenic
1159021191 18:63144683-63144705 AAAAGCAAGAAAACCAAGGATGG + Intronic
1159373301 18:67558319-67558341 AAAAACAGAATATCCAAGAATGG - Intergenic
1159444702 18:68527411-68527433 AGCAACAGGAGAAAAAAGGAAGG + Intergenic
1159514423 18:69439244-69439266 ATAAACAGGACAACAAAGCCTGG - Intronic
1159899701 18:74034590-74034612 TAATACAGCATAACAAAGAAAGG + Intergenic
1160397993 18:78585926-78585948 AAAAAAAGGAGAAGGAAGGAAGG + Intergenic
1160645259 19:185770-185792 AAAATGAGGATATCTAAGGAGGG - Intergenic
1160655452 19:265213-265235 AGGCAGAGGATAACAAAGGAAGG - Intergenic
1161644587 19:5445184-5445206 AAAAAAAAGAAAAGAAAGGAAGG + Intergenic
1161762075 19:6181234-6181256 AAAAAAAGGAAAGGAAAGGAAGG + Intronic
1161926386 19:7303523-7303545 GAAAAAAGGAAATCAAAGGAAGG + Intergenic
1162357039 19:10192606-10192628 AAAAAAGGAATAAAAAAGGAAGG + Intronic
1162412077 19:10512401-10512423 AAAAAAAGGATAACAAAATAAGG - Intergenic
1162422457 19:10573645-10573667 AAAAAAAGGAAAAAAAAGCAGGG - Intronic
1162504350 19:11074212-11074234 AAGAACAGGTAAACAAAAGATGG + Intergenic
1162623221 19:11861340-11861362 AAAACCAGGAAAAGATAGGAGGG - Intronic
1162627103 19:11893620-11893642 AAAACCAGGAAAAGATAGGAGGG - Intronic
1162634913 19:11960312-11960334 AAAAACAAGAAAACAAGAGACGG - Intronic
1162636247 19:11969911-11969933 AAAACCAGGAAAAGATAGGAGGG - Intronic
1162701669 19:12520179-12520201 CAAAAAAGAACAACAAAGGAAGG + Intronic
1163917070 19:20249722-20249744 AAAAAAAGGAAAAAAAAAGAAGG - Intergenic
1164169385 19:22711429-22711451 AAAAAAAGGAGAATAAAGGAGGG - Intergenic
1164292798 19:23882411-23882433 GAAAAGAGGAGAAAAAAGGAAGG + Intergenic
1164498892 19:28795099-28795121 AATAAAAGGAAAAAAAAGGAAGG - Intergenic
1164815985 19:31203853-31203875 GAAAACAGGCTAATACAGGAGGG - Intergenic
1164888070 19:31800330-31800352 GAAGACAGCAGAACAAAGGAAGG - Intergenic
1165505489 19:36225737-36225759 AAAAAAAGAATCACAAAGCAGGG - Intronic
1165844280 19:38808319-38808341 AAAAAGAGGAAAAAGAAGGAAGG + Intronic
1165893749 19:39129716-39129738 AACCACAGGAGAAGAAAGGATGG + Intronic
1166093493 19:40525305-40525327 AAAAAAAGTGGAACAAAGGAAGG - Intronic
1166638335 19:44471850-44471872 AAAATCAGGATATCACAGCATGG + Intergenic
1167356065 19:49004981-49005003 AAAAACAGGAAAGAAAATGAGGG + Intronic
1167393625 19:49212670-49212692 AAAAAGAAGAAAAGAAAGGAAGG - Intergenic
1167779106 19:51584820-51584842 AAAAACAGAATAACAAGTGTTGG + Intronic
1167869093 19:52352655-52352677 AAAAACAGGAAAAAAAAAGTGGG - Intronic
1168627368 19:57929985-57930007 AAAAACAGAATTTCTAAGGAGGG + Intronic
1168711017 19:58499928-58499950 AGGAAAAGGATAACAAGGGATGG + Intronic
925004921 2:434986-435008 AAAAAAAGAAAAAGAAAGGAAGG - Intergenic
925487900 2:4356505-4356527 ACAAACAAGAAAACACAGGAAGG + Intergenic
925621280 2:5795502-5795524 AGAAACAGAATAACAAAAGGAGG - Intergenic
925790094 2:7475865-7475887 GAAAACAGAATAACAGAGGCTGG + Intergenic
925971463 2:9109587-9109609 AAAAAAAGGAAAACACAGAAAGG + Intergenic
925993940 2:9276516-9276538 AAAAAAAAGATGACACAGGAAGG - Intronic
926235083 2:11035106-11035128 AAAAAAAGAAAAAAAAAGGAAGG + Intergenic
926460586 2:13125051-13125073 ATAAAAAGGAAAAAAAAGGAAGG + Intergenic
926471400 2:13263594-13263616 AGAAACAGAATCACAAAGAATGG - Intergenic
926536616 2:14121131-14121153 AAAAAAAGAAAGACAAAGGAAGG - Intergenic
926617086 2:15007430-15007452 AAAATCAAGAGAGCAAAGGATGG - Intergenic
926743138 2:16128729-16128751 ACAAACAGGAAAACTAAGAAGGG - Intergenic
926847772 2:17160914-17160936 AGGACCAGGAAAACAAAGGAAGG - Intergenic
926993888 2:18712853-18712875 AAAAACAGAATAAAAAATAAGGG - Intergenic
927004011 2:18828567-18828589 AATAATATTATAACAAAGGAAGG - Intergenic
927043124 2:19249747-19249769 TATAACAGGATCAGAAAGGATGG + Intergenic
927063426 2:19445707-19445729 AAAAACAGTTGAAAAAAGGAAGG - Intergenic
927239367 2:20907120-20907142 TAAAAGAGGATAACAACAGATGG - Intergenic
927794753 2:26038182-26038204 AAAAACAAACAAACAAAGGAGGG - Intronic
927947758 2:27147572-27147594 AAAAAAAGGAAAGGAAAGGAAGG - Intergenic
928049606 2:27976963-27976985 AAAATCTGTAGAACAAAGGATGG - Intronic
928075765 2:28263143-28263165 AAAAAGAAGAAAAGAAAGGAAGG + Intronic
928156347 2:28880545-28880567 AAAAAAAGAAAAAGAAAGGAAGG - Intergenic
928277810 2:29919245-29919267 AAAAGCAGGAAAACCAACGATGG + Intronic
928326197 2:30321558-30321580 AAAAAAAGAAGAAAAAAGGAAGG - Intronic
928555221 2:32416828-32416850 AATAAAAGGAAAAGAAAGGAGGG - Intronic
928694755 2:33838093-33838115 AAAAAAAGGATAAAGTAGGATGG + Intergenic
928756397 2:34530899-34530921 AAGTACAGGATCACATAGGATGG + Intergenic
928803563 2:35124619-35124641 AAAAAAAGGAAAACAAAAAATGG - Intergenic
929169004 2:38912432-38912454 AATAACAGGATTACACAGAAAGG - Intronic
929221093 2:39465885-39465907 AGAAACAGGAAAAGAAGGGAAGG - Intergenic
929443141 2:41981427-41981449 AAAAAAAGAAGAAGAAAGGAAGG + Intergenic
930277905 2:49334993-49335015 AAAAAGAGGGAAAGAAAGGAGGG - Intergenic
930374786 2:50551389-50551411 AACAGCAGAATAAAAAAGGAAGG + Intronic
930471315 2:51818014-51818036 AGAAACAGGAAAAGAAAGAAGGG + Intergenic
930774631 2:55159869-55159891 AAAAAAAAGATAAGAAAGAAAGG - Intergenic
930925272 2:56810534-56810556 AAAACCAGGATAATAACGGGAGG - Intergenic
931373209 2:61683391-61683413 AAAAAAAAGAAAAAAAAGGAGGG + Intergenic
931440322 2:62285754-62285776 AAAGAAAGGAAAAGAAAGGAAGG + Intergenic
931614183 2:64138815-64138837 ACAAACAGGAAAATAAAGCAGGG - Intronic
932904713 2:75737596-75737618 AAAAAAATGAAAAAAAAGGAAGG - Intergenic
933718247 2:85377972-85377994 AGGAAGAGGAGAACAAAGGAAGG + Intronic
934139606 2:89032820-89032842 AAAAAAAGGATATTAAAGGCTGG + Intergenic
934229636 2:90167723-90167745 AAAAAAAGGATATTAAAGGCTGG - Intergenic
935053406 2:99543917-99543939 AAAAAAAGGAAAAAAAAGCAGGG - Intergenic
935927320 2:108083629-108083651 AAAAGGAGGATAAGAATGGAGGG + Intergenic
935966416 2:108480991-108481013 AAAAACAGGATTTATAAGGAAGG + Intronic
936392147 2:112085105-112085127 ATAAACAAAAGAACAAAGGAGGG - Intronic
936395856 2:112129069-112129091 AAAAACAGAATAATAAAATATGG - Intergenic
936650685 2:114422736-114422758 AAAAAGAGGAAAATAAAGTATGG + Intergenic
936662707 2:114559900-114559922 AAAAAAAAAAAAACAAAGGAAGG + Intronic
936684881 2:114816175-114816197 AAAAAAGGGCTAACAAAGGGAGG - Intronic
936830119 2:116633792-116633814 AAAAAAAGCATACAAAAGGAAGG - Intergenic
937030403 2:118734313-118734335 AAAAATAGAAGAATAAAGGAAGG + Intergenic
937172079 2:119883890-119883912 TAAAACAGGATAACAAACCATGG + Intronic
937693526 2:124782156-124782178 AACAAAAGGATAAAAAATGATGG - Intronic
938313703 2:130312117-130312139 AATGACAGAGTAACAAAGGAAGG + Intergenic
939311685 2:140487048-140487070 AAACTCAGAATAACAAAAGATGG + Intronic
939356479 2:141109553-141109575 AAACATAGTATAACAAAGTATGG + Intronic
939370461 2:141292480-141292502 AAAAACAGAATAGAAAAGCAAGG + Intronic
939935102 2:148281770-148281792 AAAACCAGGAAGACAGAGGAGGG - Intronic
939997403 2:148932633-148932655 CAGAAGAGGATCACAAAGGAGGG - Intronic
940181213 2:150935269-150935291 GGAAACAGGAAAATAAAGGAAGG + Intergenic
940186707 2:150993167-150993189 GACAACAGGATAAAAAATGAGGG - Intergenic
940315556 2:152324483-152324505 AAAAAAAGGAAAAGAAAGAAAGG - Intergenic
940665092 2:156599372-156599394 AAAAACCAGATACCAATGGATGG + Intronic
941174048 2:162175447-162175469 CACAACAGAATACCAAAGGAAGG + Intronic
941409481 2:165136194-165136216 AAACACAGGATAAGAGAGGCTGG - Intronic
941612664 2:167680549-167680571 AAAAACAGGATAAAAATAGAGGG - Intergenic
942316872 2:174705250-174705272 AAAAACAGGGGCCCAAAGGAAGG - Intergenic
942586618 2:177486402-177486424 GAAAACACTATTACAAAGGAAGG - Intronic
942773147 2:179546881-179546903 AAAGACAGAATAACAAATGTTGG - Intronic
942925044 2:181421462-181421484 AAAGACTAGATAACAAATGAGGG + Intergenic
942975299 2:182009883-182009905 AAAAAACGTATAACAAGGGAAGG - Intronic
942985853 2:182140808-182140830 ACAGAGAGGAAAACAAAGGAAGG + Exonic
943180971 2:184540501-184540523 AAAAAGAGAAGAAAAAAGGAAGG + Intergenic
943343778 2:186712989-186713011 ACAAATAGCATAACAAATGAGGG + Intronic
943497759 2:188645398-188645420 AAGAAAAGGAGAACAAAGAATGG - Intergenic
943765006 2:191651200-191651222 AAAAAGAGGATCAGAAAGAAAGG + Intergenic
944129769 2:196335039-196335061 AAAAGCAGTCTAACAAAGCATGG + Intronic
944563709 2:200966369-200966391 AAAAACAGGTTAACATAAGTTGG + Intergenic
944902785 2:204232603-204232625 AGAAACAGGAGAAGAAAGGGCGG + Intergenic
945381225 2:209143499-209143521 TAAAACAAAATAAAAAAGGAGGG + Intergenic
945588616 2:211699072-211699094 AAAAACACCATTACAAATGAAGG + Intronic
945759287 2:213893052-213893074 AAAAACAGAAAAAGAAAAGAAGG + Intronic
946220881 2:218225718-218225740 AAGTAGAGGATAAAAAAGGAAGG - Intronic
946701168 2:222415777-222415799 AAAAACAGGAAAAAAAAAGAAGG - Intergenic
947053217 2:226070738-226070760 AAAACCAGGAAGACATAGGAAGG - Intergenic
947297345 2:228646130-228646152 AAAATTAGGAGAAAAAAGGAAGG + Intergenic
947816064 2:233037873-233037895 AAAAAAAGGAAAAAAAAGAAGGG + Intergenic
948418033 2:237831220-237831242 AAAAAAAGGACAAATAAGGATGG - Intronic
948780436 2:240318495-240318517 AAAAACAGAAAAACCAAGAATGG + Intergenic
1168991015 20:2095665-2095687 AAAAAAAAGATAGCAAGGGATGG - Intergenic
1169176311 20:3518112-3518134 AAAACCAGTCTAACAAAGTATGG - Intronic
1169569668 20:6892111-6892133 AAAAACAAGCAAACAAAGCAAGG - Intergenic
1169893692 20:10479707-10479729 AAAAACAGGCAAACAGAGGCCGG + Intronic
1170030715 20:11941201-11941223 AAAATCATGATAAATAAGGAAGG + Intergenic
1170296116 20:14827965-14827987 AAAAGAAGGAAAACAAAAGATGG - Intronic
1170583473 20:17716328-17716350 AAAAAAAGGAAAAGAAAAGAAGG - Intronic
1170798604 20:19571469-19571491 AAAAGAAGGAGAACAAAGGGGGG + Intronic
1170915663 20:20622266-20622288 AAAAACAGGAAAAAAAAAGATGG + Intronic
1170995413 20:21351254-21351276 AAAAACAAAATAACAAATGTTGG - Intronic
1171122465 20:22578754-22578776 AAAAAAAGAATAATAAAGGAGGG + Intergenic
1172584408 20:36072434-36072456 AAAAACAGGAAAAGAAACCATGG + Intergenic
1172758564 20:37305888-37305910 ATAAACAGGATTACAAAGAGAGG + Intronic
1172906810 20:38376597-38376619 AAAAACAGGACAGGACAGGATGG - Intronic
1174321521 20:49745626-49745648 AAAAAAAGAAAAACAAAGGCTGG + Intergenic
1174434546 20:50496713-50496735 AAAAAAAGGAAAAAGAAGGAAGG - Intergenic
1174438495 20:50529413-50529435 AAAAACTGGATGACAATGGGAGG + Intronic
1174973478 20:55304807-55304829 AAAAAGAGAATAAAAAAGAATGG - Intergenic
1176280253 20:64300451-64300473 AAAATGAGGATATCTAAGGAGGG + Intergenic
1176456437 21:6916371-6916393 AAAAAAAGGATAACTGAAGAGGG - Intergenic
1176834611 21:13781431-13781453 AAAAAAAGGATAACTGAAGAGGG - Intergenic
1177532346 21:22376522-22376544 AAAACAAGGAAGACAAAGGATGG - Intergenic
1178307522 21:31502956-31502978 AAATAGAGGAAAAAAAAGGATGG + Intronic
1178691697 21:34755265-34755287 AAAAAGAGGAGAAAACAGGAGGG + Intergenic
1179801292 21:43812585-43812607 AAAGAAAGAAGAACAAAGGAGGG - Intergenic
1181297916 22:21856579-21856601 AAAAACAACAAAAAAAAGGAAGG + Intronic
1181317527 22:21980334-21980356 AAAACCAGAAAAATAAAGGAGGG + Intronic
1181779490 22:25182407-25182429 AAAAGAAGGATAAAAAAGGATGG - Intronic
1182237998 22:28891809-28891831 AAGAAGAGGAAAAGAAAGGAAGG - Intronic
1182469643 22:30540352-30540374 AAAAAAAGGAACAAAAAGGAGGG - Intronic
1182899571 22:33886668-33886690 AAAAAAAGAAAAAAAAAGGAAGG + Intronic
1183815063 22:40292990-40293012 AAAAATAGCACAACAAAAGAAGG - Intronic
1184059309 22:42072525-42072547 AAAAACAGGAGAAAGAAGGGGGG + Intergenic
1184531671 22:45060138-45060160 AAAAACAGAAGAGCAAATGAGGG + Intergenic
1184830803 22:46985110-46985132 TGAAAGAGAATAACAAAGGAAGG + Intronic
1185401705 22:50622128-50622150 AGAGAGAGGAGAACAAAGGAAGG + Intergenic
949119113 3:364153-364175 GAAAACAGGATGAAAAAAGAAGG - Intronic
949481236 3:4495273-4495295 AATAACAGGGTAACAGAGGTAGG + Intronic
949530490 3:4950572-4950594 AAAAAAAGGAGAAGAAAGAAAGG - Intergenic
949587468 3:5455949-5455971 AAAAACATTATATCAGAGGAGGG + Intergenic
950084141 3:10245302-10245324 AAGCAGAGGAGAACAAAGGAAGG - Intergenic
950156437 3:10724727-10724749 AAAAAGAAGAAAAGAAAGGAGGG + Intergenic
950278685 3:11686024-11686046 AAAAACAAAATAACAAATGTTGG + Intronic
950287331 3:11755162-11755184 AAAGCCTGGATAACAAAGGGTGG + Intergenic
950896346 3:16455040-16455062 AAAAACAGGCTGATAAATGAGGG + Intronic
951656937 3:25019760-25019782 AACAACAGGGTACCCAAGGAGGG + Intergenic
951692716 3:25413633-25413655 AAAAACAAGATACCAAGGGTTGG - Intronic
951820226 3:26800397-26800419 AAAGACATGAAAAAAAAGGAGGG + Intergenic
951946074 3:28137775-28137797 ATAAATAGGAAAACAAAGGGAGG + Intergenic
952474625 3:33694942-33694964 CAAAAAAGAAAAACAAAGGAAGG + Intronic
952610277 3:35200452-35200474 AGAAAGAGGAAGACAAAGGAAGG + Intergenic
952634632 3:35512798-35512820 AAGAACAAGATAACAAAAAAGGG + Intergenic
952709789 3:36418170-36418192 ATAAAAAGAAAAACAAAGGAAGG - Intronic
952753638 3:36846670-36846692 AAAAACAGGAAAAAAAATTATGG - Intronic
953261232 3:41340977-41340999 ACAAACAGGATATCTGAGGATGG + Intronic
953859804 3:46533889-46533911 AAAAAAAAGAAAAGAAAGGAAGG - Intronic
953862314 3:46555412-46555434 TAAAATAGGAAAACAAAAGAGGG - Intronic
953994460 3:47509058-47509080 AAAAAAAGGAAAAAAAAGGCTGG - Intronic
954187491 3:48929339-48929361 AAAAACAAAAAAAAAAAGGAAGG - Intronic
955732320 3:61999504-61999526 AAAGACAGGAGAACAATGAATGG - Intronic
955853213 3:63243896-63243918 AAAAACAGGCTAAGCTAGGAAGG + Intronic
955932511 3:64071764-64071786 AAAAACAGGAAAACAAGTCATGG - Intergenic
956433710 3:69212404-69212426 AAAAAAGCGATAACAAAAGATGG + Intronic
956657333 3:71565206-71565228 AAAAAAAGGATGAGAAATGATGG + Intronic
956901331 3:73719082-73719104 AAAAAAAAGAAAAGAAAGGAAGG + Intergenic
957354668 3:79066169-79066191 AAAATCAGTAAAACTAAGGATGG + Intronic
957467854 3:80618733-80618755 CAAAAAAGAAAAACAAAGGAAGG - Intergenic
958089988 3:88865187-88865209 AAAAACTAGATAACAGAGGCCGG + Intergenic
958709999 3:97706772-97706794 AAAAACAACAAAACAAAGGAGGG - Intronic
958792355 3:98666511-98666533 AAAAAAATGATAACAAATGTTGG - Intergenic
958906628 3:99948744-99948766 AAAAAGAGGAAAAGGAAGGAAGG + Intronic
958949894 3:100405086-100405108 AAAAAATGGATAACACAGGCTGG - Intronic
959019406 3:101171893-101171915 AAGAGCAGGATTACAGAGGAAGG + Intergenic
959416955 3:106087194-106087216 AAAAAAAGGTTAATAAAGAAGGG + Intergenic
959426495 3:106196192-106196214 AAAAAAATGATAAGAAATGATGG + Intergenic
959545239 3:107588316-107588338 AACAACATGATCACAAAGTAAGG + Intronic
959753412 3:109865819-109865841 AAAAACAACATAACAAATGAAGG + Intergenic
959830573 3:110857046-110857068 AAGAGCAGGAAGACAAAGGATGG + Intergenic
959896896 3:111616314-111616336 AAGAAGAGATTAACAAAGGAAGG + Intronic
960310777 3:116113823-116113845 AAAAACAAAATGACAAAGAATGG + Intronic
960323609 3:116267692-116267714 AAAAACAGACGAACAGAGGATGG - Intronic
960531073 3:118765618-118765640 AACAACAGCATAACAACAGAAGG + Intergenic
960674597 3:120182026-120182048 AAAAAGGGGAGAACAAAGGCAGG + Intronic
960923851 3:122777613-122777635 AAAAAAAGGATTAGAAAGAAAGG + Intronic
960924673 3:122782569-122782591 AAAAAAAGGATTAGAAAGAAAGG + Intronic
961228315 3:125275011-125275033 AAGAACAGAATAATAAATGATGG + Intronic
961299064 3:125910334-125910356 AAAAAAAGGAAAAGAAGGGAGGG + Intergenic
961533596 3:127555587-127555609 AAATACAGCATCACAAAGGTTGG + Intergenic
961991110 3:131192272-131192294 AAAAACAAAATAACAAATGTTGG + Intronic
962332484 3:134490714-134490736 AAAAACAGTATCAGTAAGGAAGG - Intronic
962433522 3:135343277-135343299 AAAACCAGGATAACTGAGTAAGG + Intergenic
962495447 3:135935379-135935401 ACAAACAGGATAAAAAAAAAAGG + Intergenic
962530944 3:136279563-136279585 AATAACAACATAAAAAAGGAAGG - Intronic
963031002 3:140976144-140976166 AAGCTCAGGATAAAAAAGGATGG - Intronic
963806900 3:149732006-149732028 GAAAATAAGAAAACAAAGGATGG + Intronic
964618107 3:158691882-158691904 AACAACCCGTTAACAAAGGAAGG - Exonic
964834048 3:160917726-160917748 AAAAACATGATTTCAAAGGAAGG + Intronic
964864769 3:161244624-161244646 AAAAAAAGGAAAAGAAATGAAGG - Intronic
964935226 3:162076040-162076062 AAGAACAGGATAGAAAAGGCCGG - Intergenic
964988696 3:162777802-162777824 AAAAATAGAATAACAAATAATGG + Intergenic
965546401 3:169920662-169920684 AAAAACAAAAAAACAAGGGAAGG - Intronic
965699942 3:171450376-171450398 AAAACCAGTCTAACAAAGTATGG - Intronic
965820395 3:172679111-172679133 AGGTACAGGAGAACAAAGGAAGG + Intronic
965953133 3:174334980-174335002 ACAAACAGGATTGCAAAGTATGG - Intergenic
966636188 3:182136363-182136385 AACAACAGAATCACAGAGGAGGG + Intergenic
966700300 3:182841985-182842007 AAAAAAAAAAAAACAAAGGATGG + Intronic
967143419 3:186584216-186584238 AAAAACAAGTAAACAAAGAAAGG - Intronic
967357065 3:188583492-188583514 AAACACAGGAGAACACAGCAAGG - Intronic
967389872 3:188945210-188945232 AAAAGCAGGAAAAGAAAGGGAGG - Intergenic
967524671 3:190477146-190477168 AAAAACTGAATAACACAGGAGGG + Intergenic
967530182 3:190540300-190540322 AAAAACAGAAGGACAAAGGGAGG - Intronic
968224581 3:196965758-196965780 ACACACTGGTTAACAAAGGAGGG - Intronic
968372423 3:198233756-198233778 AAAATGAGGATATCTAAGGAGGG + Intergenic
969399439 4:6944231-6944253 AAAAGCAGGACACCAAACGATGG - Intronic
969828504 4:9777046-9777068 TCAAACAGAATAACAAAAGAGGG - Intronic
970007652 4:11427093-11427115 AAAAAAAGAAAAAAAAAGGAGGG - Intronic
970316840 4:14835970-14835992 AACCACATGACAACAAAGGAAGG - Intergenic
970427666 4:15960622-15960644 AAAAAAAGAAAAAAAAAGGAAGG + Intronic
971065024 4:23021716-23021738 TAACACAGAATAATAAAGGAAGG - Intergenic
971473094 4:27048190-27048212 AAAAACACGCAAAAAAAGGAAGG + Intergenic
972045403 4:34659165-34659187 AAAGAGAGGAAAAGAAAGGAGGG + Intergenic
972089856 4:35267888-35267910 AAAATCAGGATAACAGAGAGAGG - Intergenic
972157748 4:36185677-36185699 AAAAATAGGATAATAATGGATGG + Intronic
972369249 4:38406803-38406825 AAAAAGAGAATAACAAACAATGG - Intergenic
973157707 4:46977364-46977386 AAGAAAAGAATAAAAAAGGAAGG + Intronic
973268893 4:48240327-48240349 AAAAGCAGGAAGAGAAAGGAGGG + Intronic
973692338 4:53450076-53450098 AAAAAAGGGATAACAAAGAATGG - Intronic
973722033 4:53733803-53733825 AAAAAGGGGAGGACAAAGGAAGG + Intronic
974825979 4:67131603-67131625 GAAAACAGGATAACAGAGACTGG + Intergenic
975083692 4:70310737-70310759 AAAATCAGGGTAACAGAGGGAGG + Intergenic
975328574 4:73087948-73087970 AAAGAGAGGAAAAAAAAGGAGGG + Intronic
975514607 4:75232709-75232731 ATAAACAGGATAAAAACAGAGGG + Intergenic
975775012 4:77776992-77777014 GAAAACAGAAAAACAAAGGCAGG + Intronic
975828112 4:78340881-78340903 AAAATAAGGATATTAAAGGATGG - Intronic
975914217 4:79304046-79304068 AAAAACAGAAAAACACATGATGG - Intronic
975959073 4:79878752-79878774 AGAATTAGGATAACAAAAGATGG + Intergenic
976303124 4:83534498-83534520 CAAACCAAGATAACTAAGGAAGG - Intergenic
976762409 4:88563956-88563978 AAAAACTGGATATAAAAGGAAGG - Intronic
976909269 4:90280379-90280401 AAAAACAGGAGATGGAAGGAGGG - Intronic
977104721 4:92866845-92866867 AAAAAGAGGATAACATCGGCCGG - Intronic
977141100 4:93373255-93373277 AGAGAGAGGATAACAAAAGATGG - Intronic
977142634 4:93393353-93393375 AAAAAAAGGAGAACACAGAAAGG + Intronic
977290522 4:95160455-95160477 AAAAAAAAGAAAACAGAGGAAGG - Intergenic
977381504 4:96279906-96279928 AAAAAAAGGATATTGAAGGAGGG - Intergenic
977687261 4:99861501-99861523 AAAAATAGGACATGAAAGGAAGG + Intronic
977695609 4:99961717-99961739 TAAAACAGGAAAAAAAAGGCTGG - Intergenic
977992368 4:103460102-103460124 ATAAATAGAATAACAAAGGCTGG - Intergenic
978937337 4:114394097-114394119 AAATGCAAGAAAACAAAGGAAGG + Intergenic
979044719 4:115849006-115849028 AAAAACAGGAAAATAAATCAAGG + Intergenic
979221803 4:118235031-118235053 AAAAAAAGAAAAAAAAAGGAAGG + Intronic
979261109 4:118646215-118646237 AAAATGAGGATATCTAAGGAGGG + Intergenic
979833999 4:125338839-125338861 AAAAACAGAAGAATAAAGGTGGG - Intronic
979854473 4:125614020-125614042 AAAAACAAGAGAATAAAGTAGGG - Intergenic
980132712 4:128831536-128831558 CAAACCAGGTTAAAAAAGGAGGG - Intronic
980273092 4:130612327-130612349 AATAAAAGGATAAAAAAGAAGGG - Intergenic
980425706 4:132625223-132625245 AATAACAGCATAATAAAGGTGGG - Intergenic
980431559 4:132705950-132705972 AAAAATATGATACCAAAGAAAGG - Intergenic
980812047 4:137895462-137895484 AAAAAAAGGAAAAGAAAGAAGGG + Intergenic
981209641 4:142087587-142087609 AAAAACAGGAGAAAATAAGATGG + Intronic
981283439 4:142987703-142987725 AAACACAGCATAACAAAACATGG - Intergenic
981635990 4:146879840-146879862 GAAAACAGGACAAAAAAAGAAGG + Intronic
981693404 4:147534219-147534241 AAAAAGAGGATACAAAAGAAGGG + Intronic
981884407 4:149656091-149656113 AAAAACAGGAAAACTAAGGCTGG + Intergenic
981917100 4:150046438-150046460 AAGAACAGGAGAAGAAAGAAAGG + Intergenic
981979944 4:150779445-150779467 CAAAACAGGAAAACACATGAAGG + Intronic
982030116 4:151292305-151292327 AAAAAAAGGAAAAGAAAAGAAGG + Intronic
982383773 4:154778221-154778243 TAAACCAGGATAAGAAAGTAAGG + Intergenic
982790373 4:159585193-159585215 AAAAAAAGAAGAAGAAAGGAAGG + Intergenic
982879555 4:160694811-160694833 GAAACCAGAATAACAAAGAAAGG - Intergenic
982969005 4:161956170-161956192 AAATACAGTAGAACTAAGGAAGG + Intronic
983281843 4:165690643-165690665 AAAAACATAAAAACAAAGCAGGG - Intergenic
983300391 4:165918206-165918228 AAAAAAAGGATTTCAAATGATGG - Intronic
983721871 4:170865086-170865108 AAAAACAGTGTAAAAAAGCAGGG - Intergenic
983795165 4:171853387-171853409 AAAGATAGGAAAAGAAAGGAAGG - Intronic
983987453 4:174077197-174077219 TAAAAAAGGAAAAAAAAGGATGG - Intergenic
984166990 4:176314507-176314529 AAAAAAAGGAAAATAAATGAAGG + Intergenic
984294775 4:177840409-177840431 AAAAAGAGGAAAAGAAAGAAAGG + Intronic
984869465 4:184313699-184313721 ACAGACAGGATTCCAAAGGATGG + Intergenic
985354042 4:189098106-189098128 AAAAAAAGGGTAAGGAAGGAAGG - Intergenic
985733752 5:1565699-1565721 AAAAGCAGGAAAACCAGGGAAGG - Intergenic
986051407 5:4093847-4093869 AAAAAGTGAAAAACAAAGGAAGG - Intergenic
986939379 5:12931801-12931823 AAAAACACTATCAGAAAGGAAGG - Intergenic
986977796 5:13412482-13412504 AAAAAAAGGAAATGAAAGGAAGG - Intergenic
987153557 5:15064598-15064620 AAAAATAGACCAACAAAGGAAGG + Intergenic
987231777 5:15901532-15901554 AAAAACATGATAACAAGGGAAGG - Intronic
987281119 5:16414534-16414556 TAAAACAAAATAAAAAAGGAAGG + Intergenic
987332536 5:16869895-16869917 AAAAACAGAAGGAGAAAGGAAGG + Intronic
987886140 5:23815518-23815540 AAAATAAGGAAAAGAAAGGAAGG - Intergenic
988020633 5:25615490-25615512 AAAAACAGAAAAACATAGGAGGG + Intergenic
988284583 5:29195125-29195147 ATAAAAAGGCTAAGAAAGGATGG - Intergenic
988610897 5:32723896-32723918 GAAAAGAGGAGAAGAAAGGAAGG - Intronic
989701858 5:44277008-44277030 AAAAACAAGGTAAAAAAGCATGG + Intergenic
990031705 5:51268689-51268711 TAAAACATAATTACAAAGGATGG - Intergenic
990257507 5:53986375-53986397 AAAAGCAAAATAACAAAAGATGG - Intronic
991321392 5:65377041-65377063 AAAAACAGATTAAGAAAAGAGGG + Intronic
991591655 5:68257592-68257614 AAAAATTGTCTAACAAAGGAAGG - Intronic
992061220 5:73049444-73049466 AAAAACAGGATAAGACAAAAAGG - Intronic
992718818 5:79539257-79539279 GAACACAGGAAAACAAGGGAAGG - Intergenic
993584146 5:89702308-89702330 AAAAAAAGGATCATAGAGGAAGG - Intergenic
993584786 5:89710975-89710997 AAAAAAACAGTAACAAAGGAGGG + Intergenic
993899487 5:93574693-93574715 AAAAAAAATATAAGAAAGGAAGG - Intergenic
994346215 5:98690102-98690124 AAAAAAAAGATAACAAATGTTGG + Intergenic
994475368 5:100261778-100261800 AAAAAAAGAAGAAGAAAGGAAGG - Intergenic
994591244 5:101775370-101775392 AAAAACAAAAGAAGAAAGGAAGG - Intergenic
994630658 5:102282503-102282525 ATAAAAAATATAACAAAGGAGGG + Intronic
994671860 5:102771610-102771632 AACTACAGGATCACAAAGGAAGG + Intronic
994997273 5:107079674-107079696 AAAAATAGGATAAGAAAGGCAGG - Intergenic
995062570 5:107827295-107827317 AAAGAAAGGAAAAGAAAGGAAGG + Intergenic
995062584 5:107827490-107827512 AAAGAAAGGAAAAGAAAGGAAGG + Intergenic
995182195 5:109239549-109239571 AAAAACAGGATAAAGAAGCCAGG + Intergenic
995848222 5:116517343-116517365 AAAAACAGGATATAAAGTGATGG + Intronic
995900303 5:117058167-117058189 CAAAAAAGGATAAGAAAAGAAGG + Intergenic
996156330 5:120107293-120107315 AAAAGAAGGAAAAGAAAGGAAGG - Intergenic
996410791 5:123156650-123156672 ACACAGAGGATAACAAAGGCAGG + Intronic
996517007 5:124381811-124381833 AAAAAAAGAATAATAAAAGAAGG - Intergenic
996606489 5:125329144-125329166 CAAAAGAGGATATCAAATGAAGG - Intergenic
996713470 5:126567131-126567153 AAGTAGAGGAGAACAAAGGAAGG - Intronic
996820043 5:127616370-127616392 AAAAACAAGGTAACTGAGGAAGG - Intergenic
997708842 5:135985949-135985971 AAAAAGAGGGCAAGAAAGGAGGG + Intergenic
997728591 5:136144995-136145017 AAAAGAATGAGAACAAAGGAGGG + Intronic
997742735 5:136271492-136271514 CAGAATAGGATAGCAAAGGATGG + Intronic
998035629 5:138913204-138913226 AAAAACAGAATACAAAATGAAGG - Intronic
998305585 5:141072942-141072964 AAGAAAAGGAAAAGAAAGGAAGG + Intergenic
998502525 5:142645889-142645911 AAAAACAAAAAAACAAAGTAAGG - Intronic
999021141 5:148166442-148166464 AAAAACAAGATAACAGAGGGAGG - Intergenic
999021734 5:148173394-148173416 AAAAAATCGAAAACAAAGGAAGG - Intronic
999644497 5:153704458-153704480 AAAGACAGGAGAACAAGGCATGG + Intronic
999661589 5:153869507-153869529 AAACAAAGGGAAACAAAGGAAGG - Intergenic
1000004651 5:157172087-157172109 AAAAACAGAAGAAAACAGGAGGG + Intronic
1000052511 5:157575322-157575344 AAAAGCAGAAAAACAGAGGAAGG + Intronic
1000604140 5:163310349-163310371 AAAAACAGAACAAAACAGGAAGG + Intergenic
1000651628 5:163825245-163825267 TAAAGCAAGATAACAAAGAAAGG - Intergenic
1000781375 5:165486607-165486629 CACAACAGGATACAAAAGGATGG - Intergenic
1000786202 5:165547019-165547041 ACAAACAGATAAACAAAGGAAGG - Intergenic
1001195233 5:169667155-169667177 AAAAACAGAAAAACAATCGAGGG - Intronic
1001351441 5:170970759-170970781 AAAAAGGGGATACTAAAGGATGG - Intronic
1002731663 5:181339300-181339322 AAAATGAGGATATCTAAGGAGGG + Intergenic
1002752867 6:134794-134816 AAAATGAGGATATCTAAGGAGGG - Intergenic
1003369741 6:5512825-5512847 AAAAAAAGGAGAACATAGGTTGG + Intronic
1003666927 6:8119989-8120011 AAAAAAAGGATTTCAGAGGATGG - Intergenic
1003856458 6:10280869-10280891 AAGAAAAAAATAACAAAGGATGG + Intergenic
1004219211 6:13731054-13731076 AAGAAAGGGATAAGAAAGGAAGG + Intergenic
1004442565 6:15667793-15667815 AAAAGCAGGAAAAAAAAGAAGGG + Intergenic
1004520457 6:16356708-16356730 AAAAACTGGATAACCCAGGGTGG - Intronic
1004526743 6:16415915-16415937 CAAAACAGGAAAAAGAAGGAGGG + Intronic
1004555129 6:16689495-16689517 AAAAAAAGAAAAAAAAAGGAAGG - Intronic
1004756911 6:18619962-18619984 AAAAACAGAAAAACAAAGAATGG + Intergenic
1005158099 6:22831330-22831352 AGAAACAAGAAAAGAAAGGAAGG - Intergenic
1005808077 6:29493814-29493836 AAAAAAAGAATAAGCAAGGATGG + Intergenic
1006012379 6:31053890-31053912 AAAGTCAGGATGACCAAGGAGGG - Intergenic
1007377434 6:41466511-41466533 AAAAAAAGGGGAAGAAAGGAAGG + Intergenic
1008091984 6:47303307-47303329 AAAAACAAGAAAACTAAGGGGGG - Intronic
1008359665 6:50600526-50600548 CAGAACAGGAAAACAGAGGAGGG + Intergenic
1009048144 6:58251987-58252009 AAAAACAATATCACAAAGGGTGG - Intergenic
1009368760 6:62876607-62876629 AAAAACAATATCACAAAGGGGGG - Intergenic
1009504198 6:64454148-64454170 AAATACAGAAGAACAAAGGAAGG - Intronic
1009799726 6:68520456-68520478 AAAAAAAAGATAACAAATGTTGG - Intergenic
1009861703 6:69343170-69343192 AAAAAAAGAATTACAAAGGCAGG - Intronic
1010298640 6:74231979-74232001 AAAAAGAGAAGAAAAAAGGACGG - Intergenic
1010397238 6:75406438-75406460 AATTACAGGAATACAAAGGAGGG - Intronic
1010584922 6:77646200-77646222 AAAGAACGGATAACAAAGAAAGG - Intergenic
1011033649 6:82950350-82950372 AAAGACAGGCTAACAAATGCTGG + Intronic
1011666537 6:89639965-89639987 AAAAACAGTATAACTAAAAATGG - Intergenic
1011909075 6:92411908-92411930 AAAAACAGATAAATAAAGGAGGG - Intergenic
1012499125 6:99869278-99869300 AATGACTGGATAACAGAGGAAGG + Intergenic
1013120223 6:107134408-107134430 AAAAAAAGGAAAAGAAAAGATGG + Intergenic
1013235383 6:108193995-108194017 AAAGACAGGAAAAGAAAGAAAGG + Intergenic
1013313212 6:108917165-108917187 AAAAACAGTATATCTAAAGAAGG - Intronic
1013465583 6:110414589-110414611 AAAAACAGGGAAGCAAAGGCAGG - Intronic
1013521891 6:110941128-110941150 AAAAACAAAAAAACAAAGAAAGG + Intergenic
1014190444 6:118489632-118489654 AAAAAGAAAATAACAAATGATGG + Intronic
1014504629 6:122240144-122240166 AAAAAATGGAAAAGAAAGGAAGG - Intergenic
1014662139 6:124186126-124186148 AAAAAAAAGAAAAGAAAGGAAGG + Intronic
1014727241 6:124986264-124986286 AAAAACAAGGTCACAAAAGAAGG - Intronic
1015073584 6:129127674-129127696 AAAAAGAAGATAACAAATGTTGG - Intronic
1015368696 6:132425926-132425948 AAAAAAAAAATAACGAAGGAAGG - Intergenic
1015780499 6:136860711-136860733 AAAAACACAATAACAAAGGTTGG - Intronic
1016179501 6:141126789-141126811 TAAAACAGGATAATAAAAAAAGG + Intergenic
1016979661 6:149842824-149842846 AAAAACACAATAACAAAAGCAGG - Intronic
1017057496 6:150451322-150451344 ACAGAGAGAATAACAAAGGAAGG - Intergenic
1017130233 6:151102329-151102351 AAAAACTGGAAAACAAAGAAGGG - Intergenic
1017265285 6:152438462-152438484 AAAAACAGAATAACATTGTAAGG + Intronic
1017380601 6:153823971-153823993 AGAAAAAGTATAACCAAGGATGG + Intergenic
1017486737 6:154909650-154909672 AGAAACAGAATAGCAAATGAAGG + Intronic
1017499685 6:155012249-155012271 AAGAACAGGATAAGAAATGTGGG - Intronic
1017620761 6:156294064-156294086 AAAGATAAGTTAACAAAGGATGG - Intergenic
1017633151 6:156418920-156418942 AAATATAGGATAAGAAAGGTTGG + Intergenic
1018133807 6:160758106-160758128 AAGAACAGTAAAAGAAAGGATGG - Intergenic
1018140094 6:160823165-160823187 AAAAACAGGAAATCAAAAGAGGG - Intergenic
1018454543 6:163940388-163940410 AAAAACAGAAGAAAGAAGGAAGG + Intergenic
1018506784 6:164479779-164479801 AATAATAGGATAATAAAGGGAGG + Intergenic
1019392983 7:799988-800010 AAAAACAGAAAAAGGAAGGAAGG + Intergenic
1019495862 7:1340376-1340398 AAAAAAAGAAGAAGAAAGGAGGG + Intergenic
1020578663 7:9967198-9967220 AAAAAAAAGAAAACTAAGGAAGG + Intergenic
1020620462 7:10512099-10512121 AAAAACTGTATAACAAAAGCAGG - Intergenic
1020744027 7:12058257-12058279 ACACACACAATAACAAAGGAAGG + Intergenic
1020757265 7:12218224-12218246 AAAAAAAGTATAACAAATGAGGG - Intronic
1021536727 7:21713640-21713662 TAAATCAGGATAACAAGGGAAGG - Intronic
1021975787 7:26009943-26009965 AAAAAATAGAAAACAAAGGAAGG + Intergenic
1022063483 7:26825276-26825298 AAAAAGAGGAAATCAAAGGTGGG - Intronic
1022158282 7:27682141-27682163 AAAAACAAAAAAACAAAGGCAGG + Intergenic
1022442553 7:30446195-30446217 AAAAACAAAATAACAAGTGAAGG - Exonic
1022881520 7:34592702-34592724 CAAAACAGGATAAGACAGAAGGG + Intergenic
1023036624 7:36136737-36136759 AACAACAGAATAACAAATAATGG - Intergenic
1023153176 7:37221690-37221712 AAAAAAAGAAAAAAAAAGGAAGG - Intronic
1023288610 7:38645313-38645335 AAAAAAAAGAGAAAAAAGGAAGG - Intergenic
1023707773 7:42960123-42960145 AAAGACTGGATAAAAGAGGAAGG + Intergenic
1023883150 7:44332890-44332912 AAAAAAAAGAAAAGAAAGGAAGG + Intronic
1024186627 7:46955008-46955030 AAAAACAGGATTTTAATGGAGGG + Intergenic
1024474027 7:49791767-49791789 AAAGAATGTATAACAAAGGAAGG - Intronic
1026008875 7:66621283-66621305 AAAAAAAGGAAAACAAAGACCGG + Intergenic
1026253677 7:68692331-68692353 AGAACCAGAAAAACAAAGGAAGG - Intergenic
1026657204 7:72267219-72267241 AAAAACGGGATAAAACAGTAGGG + Intronic
1027247094 7:76374672-76374694 AAAAAAAAAATTACAAAGGAGGG - Intergenic
1028030811 7:85909694-85909716 ACAAACTGGATAAAAAAGCAAGG + Intergenic
1028757157 7:94450755-94450777 AACAAGAGGATATCATAGGAGGG - Intergenic
1029575421 7:101400336-101400358 AAAAATAGGAAAAAAAAGAAAGG - Intronic
1029933501 7:104398598-104398620 AAAAATAGGATAAGAAATGTAGG - Intronic
1030268118 7:107641790-107641812 AAAAACCAGATGACAGAGGATGG + Intergenic
1030333434 7:108297731-108297753 AAAAAAAATAAAACAAAGGAAGG + Intronic
1030387247 7:108878843-108878865 AAAAAAAGGAAAAAAAAGGAAGG + Intergenic
1030484315 7:110147561-110147583 AAAAACAGGTTAATAAAGAAAGG - Intergenic
1030596597 7:111547510-111547532 AAAAGCAGGATAAAAAGGGGGGG - Intronic
1030669335 7:112317922-112317944 AAAGACAGGGTAGCAAAGGACGG + Intronic
1032029843 7:128473976-128473998 AAAAAAAGGAGAAGAAAGGCCGG + Intergenic
1032187763 7:129741968-129741990 AAGAGCAGGATATCAAATGAAGG + Intronic
1032564260 7:132925235-132925257 AAAAAAAGAAAAAAAAAGGAGGG + Intronic
1033452703 7:141475773-141475795 AAAAAAAGGAAAGAAAAGGAAGG - Exonic
1034610739 7:152366081-152366103 AAAAAAAGAATAACAAATGTTGG + Intronic
1034641499 7:152607592-152607614 AAAAAAAGAAAAAGAAAGGAAGG - Intergenic
1034823744 7:154241337-154241359 TAAAACAGGGAAACACAGGAAGG - Intronic
1035511853 8:194958-194980 AAAATGAGGATATCTAAGGAGGG - Intronic
1035683328 8:1504992-1505014 AAAAACACAAAAAGAAAGGAAGG + Intronic
1035882359 8:3256318-3256340 AAAAAAAAGAGAAGAAAGGAAGG + Intronic
1036096610 8:5731961-5731983 AAAAACAAAAGAACAAAGAATGG - Intergenic
1036548223 8:9792553-9792575 AAAAAAAGGAAAGGAAAGGAAGG + Intergenic
1036797420 8:11766394-11766416 AAAAACAGGGGCACAAAGGAAGG + Intergenic
1036944045 8:13078014-13078036 AAAGAAAGGAAAAGAAAGGAAGG - Intergenic
1036985685 8:13527443-13527465 AAAGATAGTATAACAATGGATGG - Intergenic
1037353974 8:17998063-17998085 AAATTCAAGATAACACAGGAAGG - Intronic
1038028543 8:23615592-23615614 ATGACCAGGCTAACAAAGGAAGG + Intergenic
1038049690 8:23797017-23797039 AAAAAAAGGATAACAAATTTGGG - Intergenic
1038957676 8:32485107-32485129 AAAAAAAGAAAAAGAAAGGAGGG - Intronic
1039217821 8:35292701-35292723 AAAAAAAGGAAAAAAAAGGAGGG - Intronic
1039414571 8:37382689-37382711 AAAAACTGAAAAACAAAGGAAGG + Intergenic
1039752816 8:40493843-40493865 AATAACAGGAGAAGAATGGAAGG - Intergenic
1039901855 8:41758324-41758346 AAAAACAAAAAACCAAAGGAAGG - Intronic
1039931852 8:41999372-41999394 AAGAAAAGGACCACAAAGGAAGG - Intronic
1040282986 8:46077262-46077284 AAAAAAAGAATAAGAAAGAAAGG - Intergenic
1040480819 8:47824882-47824904 AACAGCAGGAGAACTAAGGAGGG - Intronic
1040751643 8:50716718-50716740 AAAAAAAGAATAAGAAAGGCAGG - Intronic
1040826672 8:51628697-51628719 AAAAACAAGAAAACAGAGGCCGG - Intronic
1040996926 8:53411834-53411856 AAAAAAAGAAAAAAAAAGGAAGG - Intergenic
1041055071 8:53977021-53977043 AGAAAAAGGAAAACAAAGGCTGG + Intronic
1041530159 8:58856739-58856761 AAAAAAAAAAAAACAAAGGAAGG - Intronic
1041619060 8:59944096-59944118 AAAAAAAAGAAAAAAAAGGAGGG + Intergenic
1041663860 8:60423791-60423813 ACAAACGGGATAAAAAAAGAAGG - Intergenic
1041740425 8:61151575-61151597 AATGACAGGATATCAAAGCAGGG + Intronic
1042144245 8:65711710-65711732 AAAAATAGCATAACCAAGTAAGG + Intronic
1042197525 8:66244657-66244679 AAAGAAAGGAAAAGAAAGGAAGG + Intergenic
1042596790 8:70457937-70457959 AAAAACAGGATGGAAAATGAAGG - Intergenic
1043299417 8:78707840-78707862 AAAAAAAGAAAAAAAAAGGAAGG - Intronic
1043658555 8:82705238-82705260 AAAAAAAAGAAAACAAAGAAAGG + Intergenic
1043707092 8:83363967-83363989 AAGATCAAGAAAACAAAGGATGG + Intergenic
1044366446 8:91352384-91352406 AAAATTAGAATAACAAAGGATGG - Intronic
1044424775 8:92038433-92038455 AAAAACAGAAACACAAAGGGAGG + Intronic
1044638367 8:94351970-94351992 AAAAAAAAGAAAACAAAGAAAGG + Intergenic
1044690638 8:94874040-94874062 AAAAAATGGGTAACTAAGGAAGG - Intronic
1044720760 8:95143609-95143631 AAATAGAGAAGAACAAAGGAGGG + Intronic
1044867866 8:96590131-96590153 GAATACAGGAGAGCAAAGGAAGG - Intronic
1044982787 8:97732907-97732929 AAAAAAAGGAAAAGAAAAGATGG + Intergenic
1045214645 8:100135524-100135546 AAAAAGAGCATAAGAAAGGGGGG + Intronic
1045487096 8:102640323-102640345 AAAAAAAGGAAAAGGAAGGAAGG + Intergenic
1045572496 8:103383207-103383229 TAACAAAGGGTAACAAAGGATGG + Intergenic
1045585032 8:103524940-103524962 AAAAACTGGATGACAGAAGAAGG - Intronic
1045594246 8:103634839-103634861 AAAAACAGAAAAAAAAAGCAGGG - Intronic
1045777905 8:105827494-105827516 AAAAAAAGAAAAACAAAGAAAGG + Intergenic
1045992034 8:108319264-108319286 AAAAACAGAAAAAGAAAGAAAGG - Intronic
1046427863 8:114078571-114078593 AAAAAAAAGAAAAGAAAGGAAGG + Intergenic
1046438324 8:114225338-114225360 AGAAAAAGGAAAAGAAAGGAAGG - Intergenic
1046528542 8:115413873-115413895 AAAGAAAGAATAACAAAAGAAGG + Exonic
1046566647 8:115910607-115910629 AAAACAAGGATAATAAAGAAGGG + Intergenic
1046732711 8:117742593-117742615 AATAAAAGTATATCAAAGGAAGG + Intergenic
1047585519 8:126268279-126268301 CAAAGCAGGATAACAAAGAAGGG - Intergenic
1047764379 8:127978445-127978467 AAAAACATGACAACTAAGGCTGG - Intergenic
1048072592 8:131038581-131038603 AAAAAAAGGAGGAGAAAGGAGGG + Intronic
1048165058 8:132055024-132055046 CATAGCAGGAGAACAAAGGATGG + Exonic
1048185998 8:132241295-132241317 AAAAACATGAAAACAATGGAAGG - Intronic
1048702940 8:137115039-137115061 AAACACAGCATAACAAAGTGTGG - Intergenic
1049070987 8:140355979-140356001 ATAAACAGGATAAGAAAAAACGG + Intronic
1049139404 8:140938787-140938809 AAGAAGAGGATAACAAAGCTTGG - Intronic
1049590425 8:143458028-143458050 AAAATCAGTAAAACAAAGAATGG + Intronic
1050192472 9:3042515-3042537 AAAAAAAAGAAAAAAAAGGAAGG + Intergenic
1050352623 9:4754802-4754824 AAAAAAAGAAAAAGAAAGGAAGG - Intergenic
1050407148 9:5321646-5321668 AAAAAGAGGAAGAAAAAGGAGGG + Intergenic
1050448255 9:5750616-5750638 AAAATCATAATAACAAATGAGGG + Intronic
1050449732 9:5767406-5767428 AACAACAGAAGAACATAGGAAGG - Intronic
1050468367 9:5957841-5957863 AAAAACAGGTTACCAAATAAAGG - Intronic
1051047880 9:12897215-12897237 AAAAAAAGGACAAAAAAGGAGGG + Intergenic
1051077647 9:13259537-13259559 AAATACAAGAACACAAAGGAGGG + Intronic
1051168354 9:14290946-14290968 AAAAATAGGTGAACAAAAGATGG - Intronic
1051237321 9:15015319-15015341 AAAAAAATGATTACCAAGGATGG - Intergenic
1051493725 9:17695961-17695983 AAAAACAGCAGACCAAAAGAAGG + Intronic
1051729054 9:20120061-20120083 AGAAAGAGGGTAACAAATGAAGG - Intergenic
1051968174 9:22855111-22855133 TAAAACAGGAATACAAATGATGG + Intergenic
1052153486 9:25151072-25151094 AAATATACAATAACAAAGGATGG + Intergenic
1052344498 9:27395674-27395696 GAAAACAGAAACACAAAGGAAGG - Intronic
1052869974 9:33495151-33495173 AAAAAAAGGAAAAGAAGGGAGGG + Intergenic
1054917090 9:70504898-70504920 AAAAACGGGATGAAAAAGAATGG - Intergenic
1055230313 9:74055964-74055986 AAAAAAAGAATAAAAAATGAGGG + Intergenic
1055401812 9:75932301-75932323 AAAAACAGGAAAACAGAAGACGG + Intronic
1055546021 9:77374126-77374148 CAAAATAAGATAATAAAGGAAGG - Intronic
1055776916 9:79776330-79776352 ATAAAAAGGAAGACAAAGGAAGG - Intergenic
1056234487 9:84579210-84579232 AAGAACAGGTCAAGAAAGGAAGG + Intergenic
1056281716 9:85047965-85047987 ACAAACAGGATAAAGAAGAATGG - Intergenic
1056486765 9:87066619-87066641 AATAACAGGATAGGAAAGAATGG - Intergenic
1056646473 9:88416299-88416321 AAAAATAGGGTAAGAAAGGATGG - Intronic
1056967622 9:91178327-91178349 ATGAACAGGAAAACAGAGGAGGG + Intergenic
1057017241 9:91663284-91663306 GAAAAGAGGAGCACAAAGGAAGG + Intronic
1057044870 9:91877955-91877977 AAAAGGAGGCTAACAAAGAAAGG + Intronic
1057084229 9:92193891-92193913 AAAAAAAGAAAAAGAAAGGAAGG + Intergenic
1057271273 9:93653012-93653034 GCAAACAGGATCACAGAGGACGG - Intronic
1058075962 9:100651470-100651492 AAAAACAGGTTAACAAGAGGGGG - Intergenic
1058307169 9:103458287-103458309 AAAAAAAAGAAAAAAAAGGAAGG - Intergenic
1058376887 9:104332861-104332883 AAACACAGCTTAACCAAGGAGGG + Intergenic
1058881426 9:109288898-109288920 AAAAAAAGGAAAGGAAAGGAAGG + Intronic
1059054119 9:110961054-110961076 AAAAAAAGGACAATAATGGAAGG - Intronic
1060322549 9:122577436-122577458 AAAAACAGAATTATAAAAGAAGG + Intergenic
1060436797 9:123600172-123600194 AAAAACAGGTTGAAAAAGGAGGG + Intronic
1061136612 9:128738001-128738023 AAAAACAAGAAAACAAAACAGGG - Intronic
1061136661 9:128738342-128738364 AAAAACAAGAAAACAAAACAGGG - Intronic
1062756069 9:138291810-138291832 AAAATGAGGATATCTAAGGAGGG + Intergenic
1185516701 X:704678-704700 AAAAACAGACTAAGACAGGAAGG + Intergenic
1185782067 X:2856456-2856478 AAAAGCAGGTTAGCAAAGTATGG - Intronic
1185861359 X:3582520-3582542 AGAAACAGATTAACAAGGGAAGG - Intergenic
1186253556 X:7695355-7695377 AAAAACATTCTTACAAAGGAAGG + Intergenic
1186972867 X:14868046-14868068 AGACAAAGGATAACAAAGGTTGG + Intronic
1186991982 X:15079925-15079947 AAAAGCAGGGTAAAGAAGGATGG + Intergenic
1187074834 X:15923954-15923976 AAAAAATGGATAACAAATGCTGG - Intergenic
1187316512 X:18200518-18200540 AAAAAGAAGAAAAGAAAGGAGGG + Intronic
1187469034 X:19552219-19552241 CAAAACAGTAAAACATAGGAGGG - Intronic
1187516398 X:19975339-19975361 AAAAAAAGAAAAAAAAAGGAAGG - Intergenic
1188026551 X:25216282-25216304 GAAAACAGGAGAAGGAAGGAAGG - Intergenic
1188050746 X:25482765-25482787 AAAAATAAGATAACAAAAAAAGG - Intergenic
1188117424 X:26262602-26262624 AAAAACAGCATAAAAAAGGAGGG + Intergenic
1188207274 X:27375890-27375912 AAGCAGAGGAAAACAAAGGAAGG - Intergenic
1188953914 X:36411726-36411748 ACAAATAGGAGCACAAAGGAGGG - Intergenic
1188960585 X:36486710-36486732 AAAAAAAGGAGTACAAGGGAAGG + Intergenic
1189020770 X:37336471-37336493 AAGAAGATGAAAACAAAGGAGGG + Intergenic
1189658198 X:43268903-43268925 AAGGAGAGGATAACAAAGGAAGG + Intergenic
1189867766 X:45349256-45349278 AAACACAGAATCAAAAAGGAGGG - Intergenic
1190226694 X:48551619-48551641 AAAAAAAGGAAAAAAAAGGCCGG - Intronic
1190429003 X:50360266-50360288 ACAAAGAGGATAGTAAAGGAAGG - Intergenic
1190642114 X:52490430-52490452 AAAAAAAGGAGAAAAAAAGAAGG - Intergenic
1190645559 X:52522436-52522458 AAAAAAAGGAGAAAAAAAGAAGG + Intergenic
1190853748 X:54272449-54272471 AAAAAAAGGATGAAAAAAGAGGG + Intronic
1191000448 X:55654970-55654992 TAATACAGGAAAACAAAGGTGGG - Intergenic
1191668151 X:63724445-63724467 ATAAACAGGAGAACAGAGGCTGG + Intronic
1191718132 X:64206596-64206618 AAAGCCAGGCTCACAAAGGATGG - Intergenic
1191836939 X:65473746-65473768 AAGAAAAGGATAACAAGGAAAGG - Intronic
1191958596 X:66673973-66673995 AGAAAAAGGAGAAGAAAGGAAGG + Intergenic
1191980486 X:66919260-66919282 AAACTCAGGATAAAAAAAGATGG + Intergenic
1192008673 X:67243731-67243753 AAAAACAGAATAAAAAAGAATGG + Intergenic
1192316975 X:70060828-70060850 AAAAAAAGAAAAAAAAAGGAAGG + Intergenic
1192370659 X:70510129-70510151 AAAAAAAGGATAAAAAAATAAGG + Intergenic
1192573959 X:72228042-72228064 AGACAGAGGAGAACAAAGGAAGG - Intronic
1193491365 X:82152881-82152903 AAAAACAGGCAAACAATGGCCGG + Intergenic
1193534995 X:82703667-82703689 AAAAACAGGCTTTCAAAGTAGGG + Intergenic
1194198221 X:90922876-90922898 AAGGAGAGGAGAACAAAGGAAGG - Intergenic
1194422849 X:93697761-93697783 AAAAACAGGAACTCAAAGTATGG - Intronic
1194447028 X:94001145-94001167 AAAAAAAGGAAAAAAAAGCATGG - Intergenic
1194813403 X:98414691-98414713 ACAAAGAGAATAACAAACGAAGG + Intergenic
1194861636 X:99005693-99005715 AAATCCAGGATAAGAAAGGAAGG + Intergenic
1195487467 X:105425581-105425603 AAAAAAAGGATAACATGAGAGGG - Intronic
1195570444 X:106393804-106393826 AAAAACATGGGAACAAAGAAAGG + Intergenic
1195815475 X:108880508-108880530 AAAAACAATAACACAAAGGATGG + Intergenic
1196095917 X:111799772-111799794 AAAAAAAGGGTAACAAATGAAGG + Intronic
1196200734 X:112883032-112883054 AAAAAAATGAAAAGAAAGGAAGG - Intergenic
1196734106 X:118969829-118969851 AAAAAAAGGAAAGAAAAGGAAGG - Intergenic
1196740398 X:119020237-119020259 AATAACTGGAGAACAAATGAGGG + Intergenic
1197019553 X:121669975-121669997 AAAAACAGGATTTCCAAGCATGG - Intergenic
1197269028 X:124405833-124405855 AAGAACAGAAGAAGAAAGGAAGG - Intronic
1197591034 X:128410365-128410387 CAAAACAAGGAAACAAAGGAAGG - Intergenic
1197964089 X:132038176-132038198 AAAAACAGTATTTCCAAGGAAGG + Intergenic
1198109961 X:133494397-133494419 ACAAAAAGGAAAACAAAGAAGGG - Intergenic
1198195130 X:134352502-134352524 AAAAAAAAGAAAAGAAAGGAAGG + Intergenic
1198425896 X:136519963-136519985 AAAAAAAAGAAAAAAAAGGAAGG + Intergenic
1198429100 X:136547992-136548014 AAAAAAAGAAAAAGAAAGGAAGG - Intronic
1198501955 X:137258957-137258979 AAAATCAGTATAACAGAGGATGG + Intergenic
1199404153 X:147436099-147436121 AAAAACAGGAACAAAATGGAGGG + Intergenic
1199414419 X:147564540-147564562 AAAAACAGTATACCACAGCATGG + Intergenic
1200543516 Y:4489955-4489977 AAGGAGAGGAGAACAAAGGAAGG + Intergenic
1201298490 Y:12486019-12486041 AAAAAGAAGAAAACAAAGAAAGG - Intergenic
1201544158 Y:15142230-15142252 AAAGAAAGGAAAACACAGGATGG - Intergenic
1201966802 Y:19745626-19745648 AAAAACAGAATAGCAATGTAGGG - Intergenic
1202382575 Y:24288627-24288649 AAAATGAGGATATCTAAGGAGGG + Intergenic
1202488209 Y:25381498-25381520 AAAATGAGGATATCTAAGGAGGG - Intergenic