ID: 908438008

View in Genome Browser
Species Human (GRCh38)
Location 1:64125762-64125784
Sequence GAGGGCTTGCTAAAGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908438004_908438008 -2 Left 908438004 1:64125741-64125763 CCTTTGGGATTGTATTCAAATGA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 908438008 1:64125762-64125784 GAGGGCTTGCTAAAGGCTGAAGG 0: 1
1: 0
2: 3
3: 18
4: 135
908438003_908438008 1 Left 908438003 1:64125738-64125760 CCACCTTTGGGATTGTATTCAAA 0: 1
1: 0
2: 2
3: 16
4: 234
Right 908438008 1:64125762-64125784 GAGGGCTTGCTAAAGGCTGAAGG 0: 1
1: 0
2: 3
3: 18
4: 135
908438002_908438008 8 Left 908438002 1:64125731-64125753 CCTTGTTCCACCTTTGGGATTGT 0: 1
1: 0
2: 1
3: 10
4: 163
Right 908438008 1:64125762-64125784 GAGGGCTTGCTAAAGGCTGAAGG 0: 1
1: 0
2: 3
3: 18
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908438008 Original CRISPR GAGGGCTTGCTAAAGGCTGA AGG Intronic
901684243 1:10934878-10934900 CAGGATTTGCTGAAGGCTGAGGG - Intergenic
903326295 1:22570748-22570770 GAGGGCTTCCTCCAGGCTCAGGG - Intronic
903609658 1:24601127-24601149 GAGCATTTACTAAAGGCTGAGGG - Intronic
904625426 1:31799537-31799559 GGGGGCTGACTCAAGGCTGATGG + Intronic
905469712 1:38182699-38182721 GAGATCTTGCTAAAGTCTCAGGG + Intergenic
906225215 1:44116466-44116488 GAGGGCATGTTATAGGCTGATGG - Intergenic
908122814 1:61001885-61001907 GAATGATTTCTAAAGGCTGAAGG + Intronic
908438008 1:64125762-64125784 GAGGGCTTGCTAAAGGCTGAAGG + Intronic
910515127 1:88052565-88052587 GAGTGCCTGAGAAAGGCTGATGG + Intergenic
910855535 1:91691463-91691485 GAGGGCTTTCAAAAGTCCGAAGG + Intronic
914218717 1:145658034-145658056 TAGTGGTTGCTAAGGGCTGAGGG - Intronic
914471299 1:147980898-147980920 TAGTGGTTGCTAAGGGCTGAGGG - Intronic
919118495 1:193311196-193311218 AAGGCCTTGCTAAAGGCAGAGGG - Intergenic
919542391 1:198865624-198865646 CAGTGCTTGCTAAAAGCTCACGG - Intergenic
921683021 1:218056411-218056433 GAGTGCTTTCCAAAGGCTGGGGG - Intergenic
922250414 1:223845061-223845083 GAGGTCTTGCTAAAAGCTGTGGG + Intronic
924212790 1:241787842-241787864 GAGGGCATGCCAGAGCCTGAGGG - Exonic
924711694 1:246534785-246534807 AAGGGCTTTCCAATGGCTGAAGG - Intergenic
1067065880 10:43103923-43103945 GGGGGCATGCTGAAGGCGGAAGG - Intronic
1069580293 10:69561242-69561264 GAGGGCTCTCTGCAGGCTGAAGG - Intergenic
1073109642 10:101053806-101053828 GGGGGCTTTCTCAGGGCTGATGG - Intergenic
1073568495 10:104556108-104556130 GAGGACTTTGTGAAGGCTGAGGG + Intergenic
1074548448 10:114420572-114420594 TAGTGGTTGCTTAAGGCTGAGGG - Intergenic
1079559808 11:21807795-21807817 TAGTGATTGCCAAAGGCTGATGG - Intergenic
1083230583 11:61315650-61315672 GAGAGAGTGCTAAAAGCTGAAGG + Intronic
1083850007 11:65359787-65359809 GAGGTCTTGGTAAAGGCTGTTGG - Intergenic
1084094083 11:66898805-66898827 GAGTGGTTGCCAAGGGCTGAGGG - Intronic
1087282909 11:96232389-96232411 GAGAGCTTCCTAAAGGCCTATGG + Intronic
1087985413 11:104672372-104672394 CAGGGCTAGCTAAAAGCTGAAGG + Intergenic
1090259096 11:125306035-125306057 GAGGGATGGCTAATGGCTTAAGG - Intronic
1092966312 12:13646945-13646967 GAGTGGTTTCTAAAAGCTGAGGG + Intronic
1099230637 12:80019933-80019955 ATGGCCTTGCTAAAGGCTGTGGG + Intergenic
1099994942 12:89768462-89768484 GAGTGCTTGCTGAAGGCAAAGGG - Intergenic
1105426994 13:20302445-20302467 GACGGCTTGCCAGAGGCTGACGG + Intergenic
1114592315 14:23877392-23877414 TAGGGATGGCTAAATGCTGAAGG + Intergenic
1114599109 14:23940057-23940079 GAGGGATTGCTCAAGGTAGAAGG + Intergenic
1114645502 14:24253966-24253988 GAGGTCTCCCTAAAGGCTGGTGG + Intronic
1114941552 14:27617721-27617743 GAGGACTTGTTACAGGCTGATGG - Intergenic
1116666828 14:47787406-47787428 TAGGGCCTGCTGAAGTCTGAGGG + Intergenic
1118470088 14:66067420-66067442 GAGGGCTTGTTAAACACAGATGG - Intergenic
1119628671 14:76206722-76206744 GAGGGCTTGTTGAAGACTGCTGG - Exonic
1120735801 14:88050985-88051007 TAGGGCTTGCCTAGGGCTGAAGG - Intergenic
1121838669 14:97114920-97114942 CAGGGCTTGCGAGAGGCTGGGGG + Intergenic
1126756583 15:51931156-51931178 AAGGGCTTGCCTAGGGCTGAAGG - Intronic
1127938886 15:63672607-63672629 GAGGTCGTGCTTGAGGCTGATGG + Exonic
1129250934 15:74308634-74308656 AAGAGCTGGCTAAAGGCTGAAGG - Intronic
1130283327 15:82535992-82536014 GAGGGATTGCTTGAGCCTGAGGG - Intergenic
1132090353 15:98943221-98943243 GTGGGCTAGCTAAGGGCAGAAGG + Intronic
1133333117 16:4988366-4988388 GAGGGCTTGGCAGAGGCTCAAGG - Intronic
1133607575 16:7403393-7403415 GAGTGGTTGCCAGAGGCTGAAGG - Intronic
1136069545 16:27779505-27779527 GAGGGCCTGCTCAAGGGTGAGGG - Exonic
1136122521 16:28148230-28148252 GAGGACTTGCTATATGCTCAAGG + Intronic
1136514598 16:30760558-30760580 GAGCTCTTGGCAAAGGCTGAGGG - Exonic
1137271391 16:46904640-46904662 GAGGGCTTGCTAATGGGTGAAGG + Intronic
1141176991 16:81727394-81727416 TAGTGCTTGCTTAGGGCTGAGGG + Intergenic
1141288160 16:82691875-82691897 GAGGTCTCGGTAAAGCCTGAGGG - Intronic
1141776906 16:86129395-86129417 TGGTGCTTGCTGAAGGCTGAGGG + Intergenic
1142214230 16:88822910-88822932 GGGCGCTGGCTAAACGCTGAAGG + Intronic
1144186817 17:12804306-12804328 GAGGGGTTGCAGAGGGCTGATGG + Intronic
1146575796 17:33990077-33990099 AAGGGCTAGCTTAAGGGTGAAGG + Intronic
1148367198 17:47064385-47064407 GAGGGCATGATAATGGCCGATGG + Intergenic
1148465808 17:47864715-47864737 GAGGGCCTGTTAGAGGCTGGGGG - Intergenic
1152200484 17:78943066-78943088 GAGGGCTTGCCTGAGGCTGAGGG + Intergenic
1152994738 18:396088-396110 GAGAGCTCACTAGAGGCTGAGGG - Intronic
1158583605 18:58708160-58708182 CAGGGCCTGTTGAAGGCTGACGG - Intronic
1160439127 18:78875692-78875714 GAGGGCGTGCTGATGGCAGACGG + Intergenic
1167224140 19:48225528-48225550 GAGGGCCTACTAAAGGCTTTCGG + Intronic
1168481595 19:56724711-56724733 GAGGGCTAGCCCAAGCCTGAGGG + Intergenic
925210348 2:2040059-2040081 GATGGATTCCTAAATGCTGAGGG - Intronic
925337202 2:3107243-3107265 CAGGGCACCCTAAAGGCTGATGG - Intergenic
925917400 2:8616448-8616470 GAGGACTTGATAAAGGAGGATGG - Intergenic
929328529 2:40648914-40648936 GAGGTCTTGCTGAAGACAGATGG - Intergenic
929992279 2:46800601-46800623 GACAGCGTGCTGAAGGCTGAAGG + Intergenic
932278754 2:70471685-70471707 GAGTGCTTGCTAAGTGCTGGGGG + Intronic
933542232 2:83661403-83661425 GAGTGGTTGCTAAAGGTTGAGGG + Intergenic
935415522 2:102813277-102813299 GAGGGCATCCTAAATGCTGTAGG + Intronic
936064530 2:109320338-109320360 GTGGGCTTGGGAAAGGGTGAGGG - Intronic
946191907 2:218011867-218011889 GAGGGCTTGTTAGAGGATGAGGG - Intergenic
946477986 2:220027513-220027535 GATGGCTAGTTAATGGCTGATGG + Intergenic
946551284 2:220804372-220804394 GAGTTTTTCCTAAAGGCTGAAGG - Intergenic
947586570 2:231360464-231360486 GAGGGCTTTCCAGAGGCTGAGGG + Intronic
948021624 2:234738085-234738107 GAGGGCTTTCTTAAGGCTGGAGG + Intergenic
1170000515 20:11608785-11608807 GAGGGCTTCCTGGAGCCTGAAGG - Intergenic
1170711862 20:18798379-18798401 AAGGGCTTGATAAAGGCTGATGG + Intergenic
1171086996 20:22246940-22246962 GAGGACGTGCTGAAAGCTGAGGG + Intergenic
1174057618 20:47809568-47809590 GAGGGCGCGCGACAGGCTGAGGG + Intergenic
1177344233 21:19848280-19848302 CAGTGCCTGCTAAAGTCTGAGGG - Intergenic
1179431781 21:41326577-41326599 GAGGCCATGCTCATGGCTGACGG + Intronic
1180013129 21:45064462-45064484 GAGGGCTTGAGAAAGGCTCTGGG + Intergenic
1183919644 22:41155092-41155114 CAGGGATTCCTAAAAGCTGAGGG - Exonic
950602606 3:14047879-14047901 CAAGGCTAGCTAAATGCTGAAGG - Intronic
952684773 3:36134999-36135021 GAGGCCATCCTAAGGGCTGAAGG - Intergenic
954295663 3:49673498-49673520 GAAGGCTGGGTAAAGGCTGCGGG + Intergenic
954416907 3:50397797-50397819 GAGGGCTGGTTAAAGGCAAAAGG - Intronic
955349693 3:58184311-58184333 GAGGGCTCGCTAAATCCTTAAGG + Intergenic
956064352 3:65381237-65381259 GAGGGAATGCTAAAATCTGAAGG + Intronic
956630487 3:71312113-71312135 AAGGGCTTGCTAAAGGTGAAGGG + Intronic
961863146 3:129934033-129934055 AGGGGCTTGCTAATGGCTGTCGG - Intergenic
963436791 3:145279790-145279812 GAGTGATTGCCAAAGACTGAGGG + Intergenic
964650926 3:159010326-159010348 GATGGCTTGCGAAACACTGAAGG + Intronic
965078233 3:164004359-164004381 GAGGCCTTGCTTCAAGCTGAGGG + Intergenic
965774478 3:172214195-172214217 AAGGGCAGGCTAAGGGCTGAGGG - Intronic
968864464 4:3198972-3198994 CTGGGCTTGCTAAGGACTGAGGG - Intronic
969235489 4:5862463-5862485 GTGGGCTTGCCAAGAGCTGAAGG + Intronic
970652399 4:18193205-18193227 GAGGGCTTGCTCCCTGCTGATGG - Intergenic
974644357 4:64672842-64672864 AAGTGCTTGCTAAAGGCAAAAGG - Intergenic
977748000 4:100574737-100574759 GTGTACTTGCTAAAGGCAGATGG + Intronic
978963076 4:114707940-114707962 GAGGCCTTGGATAAGGCTGAGGG + Intergenic
980709502 4:136545900-136545922 GAGGGCTTGTCAAAGGCTGAGGG + Intergenic
982358740 4:154495923-154495945 GAGGGCTACCTACAGTCTGAGGG - Intergenic
984445194 4:179828145-179828167 GAGGGAATGATACAGGCTGAAGG + Intergenic
985953626 5:3243536-3243558 GAGGGCCTGCTGAAGGCCAAGGG - Intergenic
987638005 5:20570684-20570706 CAGGGCTGGCTCAAGGATGAAGG + Intronic
990249389 5:53897256-53897278 TAGTGGTTGCTAAAGGCTGAAGG - Intronic
991981856 5:72240330-72240352 AAGGGATTGCTAGAGGCTGAAGG + Intronic
997955556 5:138275916-138275938 GAGGGCTTGGGAAAGGCACATGG - Intergenic
998745542 5:145254838-145254860 TAGGTCTTGTTAAAGTCTGATGG + Intergenic
1000857469 5:166417260-166417282 CAGGGCCTGCTGAAGTCTGAGGG - Intergenic
1012997632 6:105989533-105989555 GAGGGCTTGCTATAGGCACTGGG + Intergenic
1016705357 6:147100667-147100689 GAGGTCTTGTCCAAGGCTGAGGG - Intergenic
1017244819 6:152212292-152212314 GAGTGGTTGCTGAAGGCTGGAGG - Intronic
1017771430 6:157647644-157647666 GAGGCCCTGCTAATGACTGAAGG + Intronic
1019595395 7:1856144-1856166 GGGGCCTTGCCACAGGCTGAAGG - Intronic
1022132760 7:27419083-27419105 GAGGGCTTGCTTACGGCTCCTGG - Intergenic
1024292638 7:47816012-47816034 GAGGGCTTCCGCAAGCCTGAAGG + Intronic
1026602678 7:71789490-71789512 GAGGGCTTGTTAAACACAGATGG - Intronic
1032608486 7:133385129-133385151 GAGAGCATTCTAAAGGGTGAAGG + Intronic
1035131053 7:156653883-156653905 GAGGCAGTGCTGAAGGCTGAGGG + Intronic
1035915190 8:3611333-3611355 TAGGGCTTGGTGAAGCCTGAGGG + Intronic
1037885254 8:22592659-22592681 GAGGGTTTGTTAAATGCCGATGG + Intronic
1038550121 8:28460338-28460360 GATTGCTTGCTTAAGGCTGGGGG - Intronic
1039037832 8:33378685-33378707 CAGGAATTGCTAAAAGCTGAGGG + Intronic
1039546979 8:38417458-38417480 GAGGGCAGGATAAAGGCTAAGGG + Intronic
1041370540 8:57155109-57155131 GAGTGGTTGCTTAAGGCTGAGGG - Intergenic
1044826915 8:96207635-96207657 GAGGGCCAGCTAAGGGCTCAGGG - Intergenic
1045436160 8:102166806-102166828 GAGTGGTTGCCAGAGGCTGAGGG + Intergenic
1046069720 8:109235830-109235852 TAGTGCTTGCCAAAGGCTTATGG - Intergenic
1048341038 8:133538585-133538607 GAGAGGATGCAAAAGGCTGAGGG + Intronic
1049478337 8:142807196-142807218 GAAGGCCTGGGAAAGGCTGAAGG - Intergenic
1051534207 9:18138872-18138894 GAGGGCATGCAAGAGGCTTATGG - Intergenic
1055607849 9:77989614-77989636 GCGGGCTTGCTAAGGGCCTAAGG + Intronic
1056510916 9:87304919-87304941 GAAGCATTGCTGAAGGCTGAAGG + Intergenic
1056954937 9:91074180-91074202 GAGGGCTTGCAGAAAGCTCACGG + Intergenic
1057714489 9:97480155-97480177 GAGGGTTTGCTTGAAGCTGAAGG + Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1061695150 9:132367889-132367911 GAGGGCTTGCCCAGGTCTGAAGG - Intergenic
1185587333 X:1249594-1249616 GGGAGCTTGTTAAAGCCTGAAGG + Intergenic
1187568149 X:20473717-20473739 GCAGACTTGCTAAAGGCTGAAGG + Intergenic
1188882301 X:35503876-35503898 GATGGCTTGCCTAAGGGTGAGGG + Intergenic
1189469095 X:41300276-41300298 GGGGGCTGGCTAAAGAGTGAAGG + Intergenic
1189900038 X:45696999-45697021 AAGGGCTTGCTTTAGCCTGACGG - Intergenic
1191719829 X:64220242-64220264 CAGGGTTTCCTCAAGGCTGAGGG + Intergenic
1195157767 X:102141177-102141199 GAGGGAAAGCGAAAGGCTGAGGG - Exonic
1195273309 X:103254343-103254365 GAGGGCCTGGGAAAGTCTGAAGG - Intronic
1195556210 X:106227923-106227945 AAGTGCTTGCTAAAGGCAAAGGG - Intergenic
1198193562 X:134336332-134336354 GAGGGCATGCAAAAGGGAGAGGG + Intergenic
1201943729 Y:19487524-19487546 GAGGGGTTGCTGTATGCTGAGGG - Intergenic