ID: 908438151

View in Genome Browser
Species Human (GRCh38)
Location 1:64127125-64127147
Sequence AAGTGTGGAAGGAGTTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908438151 Original CRISPR AAGTGTGGAAGGAGTTTAGA TGG (reversed) Intronic
903316325 1:22510229-22510251 AGGTGTGGAAGGTGTGCAGAAGG + Intronic
904390787 1:30184440-30184462 AAATGAGGAAGGAGTGAAGAAGG - Intergenic
906423047 1:45686862-45686884 AAGTGGGCAAGGGGGTTAGAAGG - Intronic
907256137 1:53180563-53180585 AAGGCTGGAAGGAGCTTACAGGG - Intergenic
907752725 1:57278749-57278771 AATTGCGCAAGGTGTTTAGAAGG + Intronic
908438151 1:64127125-64127147 AAGTGTGGAAGGAGTTTAGATGG - Intronic
909331332 1:74415196-74415218 GAGTGTGGAAGGAAATGAGAAGG - Intronic
911969304 1:104409648-104409670 GACTGTGGAAGGAGTTGAGTAGG - Intergenic
914051050 1:144131783-144131805 AAGTGTAAAAGGAGTTTATAAGG + Intergenic
914128131 1:144833660-144833682 AAGTGTAAAAGGAGTTTATAAGG - Intergenic
917228335 1:172808164-172808186 ACTTGAGGAAGGAGGTTAGAAGG - Intergenic
919515598 1:198518389-198518411 GAGTGTGGAAGGAGGTTACGAGG - Intergenic
920684748 1:208100977-208100999 AAGAGGGGGAGGAGTTTGGAGGG - Intronic
923969602 1:239185000-239185022 GAGTTTGGAAGAAGTTTTGATGG + Intergenic
924229914 1:241954602-241954624 AAGTTTGGAAGGAGAGTTGAGGG + Intergenic
924559830 1:245148751-245148773 TAGCGTGGAAGGAATTTATAAGG + Intergenic
1062845589 10:701845-701867 AAGTGTGAGAGAAGTTTGGAAGG - Intergenic
1064732121 10:18342977-18342999 AGGTTTGGAATGACTTTAGAAGG - Intronic
1067895705 10:50176941-50176963 AAGAGTGGAAGGGGATTATAAGG - Intergenic
1067953282 10:50765037-50765059 AAGAGTGGAAGGGGATTATAAGG + Intronic
1068936053 10:62636764-62636786 AAGAGTGGAAGGATTAGAGAAGG - Intronic
1071147953 10:82597374-82597396 AAATGTGCAAGGAGTTTCAAGGG - Intronic
1071560285 10:86641105-86641127 AGGTTTGGAAGGTGTTTTGATGG + Intergenic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1072583927 10:96764834-96764856 AAGTGTTGAAAGAGTGCAGATGG - Intergenic
1073029199 10:100511321-100511343 AAGTGAGGAAGGAGACTTGATGG + Intronic
1073049624 10:100659269-100659291 AGGTCTGGAAGGAATTTAGGAGG - Intergenic
1073061205 10:100734946-100734968 GAGTGTGGCAGGAGTTTGGAAGG + Intergenic
1073237086 10:102026205-102026227 AAATGAGGAAGGAGAATAGATGG + Intronic
1073524215 10:104164378-104164400 ATTTGTGGAATGATTTTAGAGGG - Intronic
1073844423 10:107537577-107537599 AAGTGTGGAGGGAGGTAAGATGG - Intergenic
1074786629 10:116847908-116847930 AAATGGGGAAAGAGTTCAGAAGG + Intergenic
1075190681 10:120305390-120305412 AACTGTGGGAAGAGTTTAGATGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075505176 10:123014919-123014941 AAGGGTGGAATGGGTTCAGATGG + Intronic
1076134605 10:128036713-128036735 AAGGAGGGAGGGAGTTTAGAAGG - Intronic
1076257820 10:129042412-129042434 AACTGTGGAAGGTGTTTTGAAGG - Intergenic
1079546171 11:21634570-21634592 AATTGTGGAAGGATTCTTGATGG - Intergenic
1080199547 11:29652627-29652649 AAGTCAGGAAGGAAATTAGAAGG + Intergenic
1081509383 11:43753823-43753845 AAATGTGAAAGGGTTTTAGAAGG - Intronic
1081840562 11:46198184-46198206 AAGTGTGTAAGAATTTTATAAGG - Intergenic
1081901461 11:46632133-46632155 AAGTGTAGATGAAGTTTAAAGGG + Intronic
1082711454 11:56558648-56558670 AAGGGTGGAAAGAGGTTAGCTGG + Intergenic
1083221839 11:61257879-61257901 AAGGGTGGAGGGAGGGTAGAGGG + Intergenic
1083962026 11:66020056-66020078 GACTGTGGAAGGAGGTTAGGGGG + Intronic
1084607656 11:70181838-70181860 GTGTGTGGAAAGAGCTTAGAAGG - Intronic
1085990973 11:81843884-81843906 TAGTGTGGAAGGGGAATAGATGG + Intergenic
1086014291 11:82147266-82147288 AAGTGTGGAAATAGTAGAGAGGG - Intergenic
1088970945 11:114774327-114774349 AAGTTTTGCAGGACTTTAGATGG - Intergenic
1090958675 11:131536754-131536776 ACGTCTGGATGGAGTTAAGAAGG + Intronic
1091598409 12:1897780-1897802 AAGTGTTGTAGGAGTTAATAAGG + Intronic
1092776165 12:11946718-11946740 AAGTGTGGAAAGAGTTCAGGAGG + Intergenic
1092977634 12:13760737-13760759 AAATGTGGAAGGAGTGAAGATGG - Intronic
1093384237 12:18531524-18531546 AAGTGGGGAAGAAGGTGAGAGGG - Intronic
1093970729 12:25373616-25373638 AGGTGTGGGAGGAGTTTGGAGGG + Intergenic
1094171903 12:27502318-27502340 AAGTGTGGAATGATTCAAGAAGG - Intergenic
1095260155 12:40088717-40088739 AAGTGTGGTAGGGGTGTAGCAGG + Intronic
1095566746 12:43633437-43633459 AAGTGTTGAGGGAGTTAAGAAGG - Intergenic
1097268768 12:57761392-57761414 CAGTAGGGAAGGAGTTGAGAAGG + Intergenic
1097994014 12:65867709-65867731 AACTTTGGATGGAGTTTTGAAGG + Intronic
1098381064 12:69870027-69870049 CTGAGAGGAAGGAGTTTAGAAGG + Intronic
1099397114 12:82154191-82154213 ATGAGTGGCAGGAGTTCAGAGGG - Intergenic
1099621183 12:85004695-85004717 CAGTGTTGAAACAGTTTAGAGGG + Intergenic
1100209124 12:92383105-92383127 AAGTGTGGAAGAAGGTTTAATGG - Intergenic
1104199572 12:126575301-126575323 AAGTCTGGAAGGAATTTTCAAGG - Intergenic
1104937500 12:132374390-132374412 AAGTGTGAAAGGAGGCTGGAGGG - Intergenic
1105814040 13:24017040-24017062 AAGTGTGGGAGGAGGTGACAGGG + Intronic
1106810268 13:33351885-33351907 AAGTGTAGCAGAAGTGTAGAGGG - Intergenic
1108204490 13:48073924-48073946 AAGTATGGCAGAAGTTTAGGAGG + Intronic
1109114011 13:58357803-58357825 AAGGGTGGAGGGAGTGGAGATGG - Intergenic
1111002621 13:82205423-82205445 AAGTTTGGAGGGAGCTGAGATGG - Intergenic
1113655301 13:112064254-112064276 CACTGAGGAAAGAGTTTAGAAGG + Intergenic
1114486557 14:23066062-23066084 GAGGGGGGAAGGAGGTTAGATGG + Intronic
1116600780 14:46919733-46919755 TAGTGATGAAGGATTTTAGAAGG + Intronic
1117131015 14:52686967-52686989 AAGGGTGGCAGGAGTTTCAATGG + Intronic
1118348189 14:64955006-64955028 AAGTGAGGGAGGAGGTGAGAAGG - Intronic
1119431830 14:74573429-74573451 AACTGTGGCAGGAGGTCAGAGGG + Intronic
1119546287 14:75474253-75474275 AAGGGTGGAAAGAGGTTAGCTGG + Intergenic
1120989222 14:90360627-90360649 AAGAGTGGATGGAGTTGATAGGG + Intergenic
1121048435 14:90804504-90804526 AAGTGTGGCAGGAGTTTCCCAGG + Intronic
1121398285 14:93647616-93647638 AAGAGTGGGAGGAGATGAGAGGG + Intronic
1122154957 14:99744906-99744928 AACTGAGATAGGAGTTTAGAAGG + Intronic
1124684662 15:31771832-31771854 AAGTCAGGAAGGAGTTTGGCAGG - Intronic
1125114120 15:36067971-36067993 AAGTCTGGAGGGCGTTAAGAAGG + Intergenic
1126249932 15:46555544-46555566 AAATGTGTAAGGATTTTACAAGG - Intergenic
1132291858 15:100709423-100709445 GAGTGAGGAAGGAGTAGAGAGGG + Intergenic
1133562182 16:6960570-6960592 GAGTTTGGAAGGAGGTAAGAAGG - Intronic
1134275486 16:12772162-12772184 TAGTGAGGAAGGAGTGTTGATGG + Intronic
1135714659 16:24752143-24752165 AATTGTGGAATTGGTTTAGAGGG + Intronic
1137505271 16:49049140-49049162 AAAAATGGAAGGAGTTTTGAGGG + Intergenic
1137521990 16:49202344-49202366 AAGTGGTGAAGGAGTTAAAATGG + Intergenic
1138103167 16:54270732-54270754 AGGTTTGGGAGGAGTTAAGAAGG - Intronic
1138703504 16:58890375-58890397 ATGTGTGGTAGTAGTTTAGTGGG - Intergenic
1140772514 16:78217877-78217899 AAGTCTGGAAGGATCTTTGAGGG - Intronic
1141167299 16:81669159-81669181 GGGTGTGGAAGGAGGTGAGAGGG - Intronic
1141167339 16:81669345-81669367 GGGTGTGGAAGGAGGTGAGAGGG - Intronic
1141291127 16:82718894-82718916 CAGAGTGAAAGGAGTTGAGATGG + Intronic
1146003278 17:29144414-29144436 AAGGGAGGCAGGAGTTGAGATGG - Intronic
1148978564 17:51550738-51550760 AAGGGAGGAAGGGGGTTAGAGGG + Intergenic
1149368743 17:55971633-55971655 AAGGGTAGAAGGAGCCTAGAAGG - Intergenic
1149442765 17:56689118-56689140 AAATATGGAAGGAGTTTATTAGG - Intergenic
1149443423 17:56694517-56694539 CACTGGGGAAGGAGTTTTGAAGG + Intergenic
1149463912 17:56858827-56858849 AATTGTGGAGAGAATTTAGAGGG - Intronic
1149739142 17:59027022-59027044 AAGTTTGGAGGGAGTTTCAATGG - Intronic
1151152174 17:72097651-72097673 TAGTGTGGAAAGAGTTGAGCTGG + Intergenic
1152046701 17:77941414-77941436 AAGTGGGGGAGGAGTTTATTAGG - Intergenic
1152490021 17:80624955-80624977 GAGTGTGGAAGGTGTGTTGAGGG + Intronic
1152995415 18:401992-402014 AAGCCTGGAAGGAGTTCTGAAGG - Intronic
1155340386 18:24808082-24808104 AACTGTGGGACAAGTTTAGAAGG + Intergenic
1158224188 18:55183413-55183435 AAGTGTGTAAGGCCTTTTGAAGG - Intergenic
1159380818 18:67656319-67656341 AAGTGGGAAATGAGTTTAAATGG - Intergenic
1159479599 18:68971701-68971723 AAATGGGGAAGGATTTTAAAAGG - Intronic
1160657381 19:280542-280564 ACCTGTGGAAGGGGTTCAGAAGG + Intergenic
1161081804 19:2314551-2314573 AAGTGTGAAAAAATTTTAGAAGG - Intronic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1168336044 19:55598326-55598348 AGGAGTGGGAGGAGCTTAGAGGG - Intronic
1168487969 19:56780893-56780915 AAGTGTGGAATGAGTACAGTGGG - Intronic
925063892 2:914531-914553 AAGAGTGGGTGGAGGTTAGATGG - Intergenic
927056716 2:19372272-19372294 GAGTGAGGCAGGGGTTTAGAGGG + Intergenic
927407816 2:22791965-22791987 AAATGTGGAAGGGGTGAAGAGGG - Intergenic
927487729 2:23500281-23500303 ATGTCTGGAAGGAGTACAGAGGG + Intronic
927853776 2:26515603-26515625 AAGCGTGGAAGGAGCTTACAGGG + Intronic
935411760 2:102771694-102771716 AAGTGTGGAAGGCATTTTCAGGG - Intronic
935598235 2:104896558-104896580 ACTTGTGGAAGAAGTTGAGAGGG - Intergenic
938667547 2:133554244-133554266 AATTGTGGAAGGACTTTTGTAGG - Intronic
939256369 2:139749189-139749211 GAGGGTGGAAGGAATGTAGAGGG - Intergenic
941351430 2:164442075-164442097 ACGTGTGCAAAGAGTTTGGAAGG - Intergenic
941620226 2:167769302-167769324 AAGCATGGAAGGTGTTTGGAGGG - Intergenic
942543537 2:177039068-177039090 AACTGGGGGAGAAGTTTAGAGGG + Intergenic
943432856 2:187826086-187826108 AAGAGTAGAAAGAGTTAAGAAGG + Intergenic
943818787 2:192291913-192291935 ATGTGGTGAAGGAGTTTTGATGG + Intergenic
945253373 2:207783385-207783407 AAGGTAGGAGGGAGTTTAGAGGG + Intergenic
946655554 2:221942099-221942121 ATGTGGGGAAAGAGTTTTGAAGG - Intergenic
947397184 2:229697860-229697882 AACTGAGGAAGGAGTTTTCAAGG + Intronic
1172315707 20:33952621-33952643 TAGTGAGGAAGGGGGTTAGAAGG - Intergenic
1172758574 20:37305956-37305978 AGATTTGGAAGGAGTTTGGAGGG + Intronic
1175488151 20:59360290-59360312 AAGTTTGGAAGGAGGGTCGATGG - Intergenic
1177406564 21:20675491-20675513 AAGTTTTAAAGGAGTTAAGAAGG - Intergenic
1178534488 21:33401016-33401038 AAATGTGAAGGGAGTTTATACGG - Intergenic
1181390181 22:22574631-22574653 AAGAGAGGAAGGAGATGAGAGGG + Intergenic
1182926391 22:34129312-34129334 AATTCTGGAAGGAGATTAAAAGG + Intergenic
1182986434 22:34722251-34722273 AATTGTGGAAGGAGGTAAAAGGG + Intergenic
1183282590 22:36939836-36939858 AAGTGAAGAAGGAGTTTACTAGG - Exonic
1185020874 22:48374113-48374135 AAGTGGGGAAGGGGATTGGAAGG - Intergenic
1185381591 22:50510801-50510823 AAGTGTGTAAGGTGCTGAGATGG - Intronic
949731540 3:7118859-7118881 AAATGTGGAAAGATTTTGGAAGG - Intronic
950704914 3:14773580-14773602 GAGTGAGGAGGGAGTTAAGAGGG + Intergenic
950880046 3:16316325-16316347 AAGAGTCGAAGGGGTTTAGGTGG + Exonic
950887805 3:16376032-16376054 AAGTCTGGAAGGAGTATCGGAGG + Intronic
951297582 3:20957853-20957875 AAATGTTGAAGAATTTTAGAGGG + Intergenic
952048032 3:29347666-29347688 TAGTCTGGAGGGAGTTTGGATGG + Intronic
952349831 3:32523701-32523723 AAGTGTGGAGGGAGAGTATACGG + Intergenic
954834362 3:53452777-53452799 AAGAGTGACAGGAATTTAGAGGG - Intergenic
955148981 3:56348115-56348137 AAGGGTAGAAGGAATTTAGGGGG - Intronic
955382005 3:58446802-58446824 AAGTTTGGAAGAAGTTTGGCCGG - Intergenic
955535423 3:59918355-59918377 AAGTGTGGGAGGTGTTAAGAAGG + Intronic
958685510 3:97387668-97387690 AAGTGTTGGAACAGTTTAGAGGG - Intronic
960277118 3:115741585-115741607 ACGTGTGGATGGAGTTTTTATGG + Intergenic
960556832 3:119039400-119039422 AAATGTGGAAGGAGGTGAGAAGG - Intronic
960600697 3:119455203-119455225 AAGTGTGGAAGGTGGTTACCTGG - Intronic
962450093 3:135506006-135506028 AAGTGTGGTAGGAGCTGTGATGG - Intergenic
964097906 3:152954717-152954739 GAGTGTGTAAGAAATTTAGATGG - Intergenic
964975529 3:162614886-162614908 AAGTCTGGAAGGGGTTGAGGAGG + Intergenic
965247676 3:166295414-166295436 AAGTGTTGATGGAGATCAGAAGG - Intergenic
966311059 3:178594371-178594393 TAGTGTGGAAGCAGTGAAGATGG + Intronic
966495986 3:180581426-180581448 AGCTGTGGAAGGATTTTAAAGGG - Intergenic
966709895 3:182960578-182960600 AAGTATGTAAGGGTTTTAGAGGG - Intronic
967959036 3:194904254-194904276 AATGGTGGAAGAATTTTAGAAGG + Intergenic
969124702 4:4938109-4938131 GAGTGTGGAAAGAGGTGAGATGG - Intergenic
970705527 4:18797208-18797230 GAGTCTGGAGAGAGTTTAGAAGG - Intergenic
971212257 4:24630003-24630025 AAGAGTGGAAGGAGATGAGATGG - Intergenic
971374910 4:26048869-26048891 AAGTGTGAAAGGATTTTTCAAGG - Intergenic
972794881 4:42405439-42405461 GAGTCTGGAAGGATTTTACAGGG + Intergenic
972840618 4:42925904-42925926 TAGTGTAGAAGGAGTTTGGGTGG + Intronic
974869359 4:67620607-67620629 AAGTAGGGAAGGAACTTAGAAGG + Intronic
974869493 4:67622127-67622149 AAGTAAGGAAGGAACTTAGAAGG + Intronic
978151774 4:105444601-105444623 AAGTTTGGCAGGACTTTAAATGG + Intronic
980699954 4:136412535-136412557 GAAAGTGGAAGGGGTTTAGATGG + Intergenic
980745996 4:137016783-137016805 AAATGTGGAAGTAGTTAAGTAGG + Intergenic
981863198 4:149381782-149381804 GAGTTTGGATGGAGTTTAGATGG + Intergenic
982444852 4:155478420-155478442 AAGTGAACAAGGAGGTTAGAAGG + Intergenic
985202842 4:187502253-187502275 AAGTGGGGATGGAATTTAGGAGG - Intergenic
988732669 5:33988600-33988622 AAGTTTGGAATGTGCTTAGAGGG + Exonic
988986202 5:36621333-36621355 AAGTGTGGAAACAGGTGAGAGGG + Intronic
990013175 5:51025010-51025032 GAATGTGGAAAGAGGTTAGAAGG + Intergenic
991400849 5:66250250-66250272 AAGGGTTGAAGGATTTCAGAAGG - Intergenic
993183694 5:84588532-84588554 AAGAGGAGAAAGAGTTTAGAAGG - Intergenic
996412196 5:123170439-123170461 ATGCCTGGAGGGAGTTTAGATGG - Intronic
997831173 5:137151481-137151503 AAGTATGGAACAAGTTTAAAGGG + Intronic
997905970 5:137817505-137817527 AAAGAGGGAAGGAGTTTAGAAGG - Intergenic
999184221 5:149693581-149693603 AGGTGTGGCAGGAGTTACGAGGG + Intergenic
999645741 5:153715328-153715350 AAATGGGGAAGGAGTTGAGCAGG - Intronic
1000106310 5:158062317-158062339 AAGTCTGGTAGCTGTTTAGATGG + Intergenic
1000707660 5:164531330-164531352 AAGTGTAGAAGGATTTCAGAGGG - Intergenic
1001020029 5:168174893-168174915 AAATGTGGAAGGAGTTTGCTGGG + Intronic
1002195666 5:177499683-177499705 AAGTGAGGAAGGAGTTAGGAAGG - Intergenic
1003586460 6:7394047-7394069 AAGTGTGTTAGGAGTTTGTAAGG + Intronic
1005344229 6:24873663-24873685 AAGGGTGGAAGAAGTCTACAGGG - Exonic
1007709584 6:43813740-43813762 AGGTGTAGAAGGAGTTCGGAAGG + Intergenic
1008136837 6:47786729-47786751 AAGAGTGGAAGGAGATGTGAAGG - Intronic
1008680711 6:53868945-53868967 AAGTGCTGCAGGAGTTGAGAAGG - Intronic
1009523706 6:64716827-64716849 AACTGGGGAAGCAGTTTTGAAGG + Intronic
1010277259 6:73983800-73983822 AGGTGTGGGAGGAGTTTAAGTGG - Intergenic
1010932668 6:81821099-81821121 AAGTATGGTAGGACTTTAAATGG - Intergenic
1012418111 6:99031877-99031899 AAGTGCAGCAGGAGTTTAGGAGG + Intergenic
1012852723 6:104466382-104466404 AAGTGGGGAGGGATTTTAGATGG - Intergenic
1015318419 6:131843848-131843870 GAGTGTGGAAGGAATAGAGAGGG - Intronic
1015413428 6:132920793-132920815 AAGTGGGGAAGGTGTTGAGTTGG + Intergenic
1015582280 6:134738639-134738661 AAAGGAGGTAGGAGTTTAGAAGG - Intergenic
1016562635 6:145414131-145414153 GAGTGTGGAAGGAGTTGATCTGG - Intergenic
1018230855 6:161673746-161673768 GATTGTGGAAGGTGTTTTGAAGG + Intronic
1018979292 6:168589917-168589939 AGGTGTGGCATGAGTTTAGGGGG + Intronic
1018979346 6:168590132-168590154 AGGTGTGGCATGAGTTTAGGGGG + Intronic
1018979380 6:168590263-168590285 AGGTGTGGCATGAGTTTAGGGGG + Intronic
1018979392 6:168590306-168590328 AGGTGTGGCATGAGTTTAGGGGG + Intronic
1018979413 6:168590392-168590414 AGGTGTGGCATGAGTTTAGGGGG + Intronic
1018979425 6:168590435-168590457 AGGTGTGGCATGAGTTTAGGGGG + Intronic
1020488546 7:8749603-8749625 CAGTGTGGAAGGAGACTGGAGGG + Intronic
1021253257 7:18358016-18358038 GAATGTGGCAGAAGTTTAGAAGG + Intronic
1021380579 7:19961235-19961257 AGGTGTGGAAGGAGAAGAGAGGG - Intergenic
1022459229 7:30588246-30588268 AAATATGGAAGAAGTTTAGCTGG + Intergenic
1023263198 7:38379135-38379157 AAATGTGGAAAGAATGTAGAAGG + Intergenic
1025812973 7:64887273-64887295 AGGTGTGGAAGGAGTTAAGTTGG - Intronic
1030249913 7:107431100-107431122 AAGTGTGAAATGAGTTTTAAGGG - Intronic
1030422493 7:109325821-109325843 ATATGTGGAAGGAATATAGAAGG - Intergenic
1031748148 7:125532246-125532268 AAAGGAGAAAGGAGTTTAGAGGG + Intergenic
1034694973 7:153045012-153045034 AAGCTGGAAAGGAGTTTAGAAGG - Intergenic
1034870968 7:154683633-154683655 AACAGTGGAAGGATTTTACATGG - Intronic
1035088741 7:156286203-156286225 AGGTTTGGAAGAGGTTTAGATGG + Intergenic
1037003827 8:13752148-13752170 AAGTGTGGACGAAGTTTGAACGG - Intergenic
1037398264 8:18466780-18466802 AAGAGAGGCAGGAGTTTAAATGG + Intergenic
1037541369 8:19875143-19875165 AAGTGTGAAATGAACTTAGAGGG + Intergenic
1040434159 8:47373459-47373481 AAATGTGGCAGTAGTTTAGGTGG + Intronic
1040872610 8:52116453-52116475 GAGTTTGGAAGGAGTGTAAAAGG + Intronic
1043707591 8:83371448-83371470 AAGTTAAGAAGGAGTTAAGAAGG - Intergenic
1045151025 8:99408266-99408288 AAGTGTAGAAGGAGATAAGCCGG + Intronic
1045472416 8:102524250-102524272 AAGTGTGGAAGGGGTAGAGGGGG + Intergenic
1045485976 8:102632102-102632124 AAGTGTAGGAGGAAGTTAGAAGG + Intergenic
1045521057 8:102903754-102903776 AAGTGTGGAAGGGGCCTGGAGGG + Intronic
1045687490 8:104727074-104727096 AACTTTGGTAGGAGTTTAGAAGG + Intronic
1046277559 8:111983476-111983498 TAGTGTGTAATGAGTTTAGGTGG - Intergenic
1046398261 8:113670298-113670320 AATTGTAGAAGGAATTCAGAGGG - Intergenic
1046502882 8:115100822-115100844 AAGTATGGAAGGGGTTTTAAAGG + Intergenic
1048322196 8:133408752-133408774 AAGAGTAGAACGAGTTAAGAAGG + Intergenic
1048989628 8:139753599-139753621 AAATCTGGAAGGAGTACAGAAGG - Intronic
1051105633 9:13576554-13576576 AAGAGTGGGAAGAATTTAGATGG + Intergenic
1053911892 9:42914963-42914985 ATGGGTGGAAAGAGTTGAGATGG - Intergenic
1054807967 9:69411491-69411513 AAGACTTGAAGGAGTTGAGAGGG - Intergenic
1054902454 9:70383507-70383529 GAGTGTGGAAGGAGTTTGGCAGG - Intergenic
1055086447 9:72318851-72318873 AAGTGGGGCAGGAGTTACGAAGG + Intergenic
1056307388 9:85303453-85303475 ATGAGGGGAAGGAGGTTAGAGGG + Intergenic
1056599534 9:88035917-88035939 AAGTATGGAAGGTTTTCAGAGGG + Intergenic
1056678418 9:88696486-88696508 AAATTTGGAAGGAGGTTTGATGG - Intergenic
1057571784 9:96209507-96209529 GAGTTTGGAAGCAGCTTAGATGG - Intergenic
1057918447 9:99075671-99075693 AAGTTTGGAAGGAGAGGAGAGGG - Intergenic
1059405617 9:114097080-114097102 GGGTGTGAAAGGAGTTTGGAAGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061941101 9:133884421-133884443 AAGTGTGGCGGGCGTTGAGAAGG - Intronic
1062173749 9:135149392-135149414 AAGGGTGGCAGGAGTTTGGTTGG + Intergenic
1185891846 X:3828811-3828833 CAGTGTGGAAGAAGATCAGAGGG - Intronic
1185896953 X:3867225-3867247 CAGTGTGGAAGAAGATCAGAGGG - Intergenic
1187107942 X:16263716-16263738 ATTTCTGGAAGGAGTTTGGAAGG - Intergenic
1189266630 X:39721724-39721746 AAGTGTGGCATGCGTTTGGAAGG - Intergenic
1189738031 X:44091251-44091273 AAGAGTGGAAGAAGGATAGAGGG + Intergenic
1190578676 X:51869099-51869121 ATGTGTGGAAGGAGATTTGGAGG + Intronic
1191932142 X:66385761-66385783 CAGTGAGTAAGGAGTTAAGAGGG + Intergenic
1192418828 X:71010362-71010384 GAGTGTGAGAGGAGTTAAGAAGG - Intergenic
1192537343 X:71939357-71939379 CACTGTGGAAGCAGTATAGAAGG + Intergenic
1193865991 X:86730066-86730088 AAGAGTGGCATGTGTTTAGAAGG - Intronic
1195757032 X:108209205-108209227 AAGTGTGAATGGTGTTTAGCTGG - Intronic
1196049001 X:111285157-111285179 GAGTGAGGAAGGAGGTTTGAAGG + Intergenic
1196236110 X:113282377-113282399 AAGTGGGGAAGAAGTTGACAGGG + Intergenic
1197960300 X:131997311-131997333 AAGTGTTGAATGAGGTTAAATGG + Intergenic
1200123512 X:153802451-153802473 AACTGAGGAAGGTGCTTAGATGG - Exonic
1202082264 Y:21095731-21095753 AAATTTGGCAGGTGTTTAGACGG + Intergenic