ID: 908439386

View in Genome Browser
Species Human (GRCh38)
Location 1:64138488-64138510
Sequence ATGTGCTATGAGGAATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908439379_908439386 28 Left 908439379 1:64138437-64138459 CCCAAGGCAGAAACATAGAACAG No data
Right 908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG No data
908439384_908439386 -3 Left 908439384 1:64138468-64138490 CCAGAAGCTATGTGGAAGCTATG No data
Right 908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG No data
908439383_908439386 -2 Left 908439383 1:64138467-64138489 CCCAGAAGCTATGTGGAAGCTAT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG No data
908439380_908439386 27 Left 908439380 1:64138438-64138460 CCAAGGCAGAAACATAGAACAGC No data
Right 908439386 1:64138488-64138510 ATGTGCTATGAGGAATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908439386 Original CRISPR ATGTGCTATGAGGAATGTGA AGG Intronic
No off target data available for this crispr