ID: 908440182

View in Genome Browser
Species Human (GRCh38)
Location 1:64145871-64145893
Sequence GCTTCTGTATCAGCAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908440182_908440189 18 Left 908440182 1:64145871-64145893 CCTATTTTTGCTGATACAGAAGC 0: 1
1: 0
2: 1
3: 23
4: 218
Right 908440189 1:64145912-64145934 AGGGTCATCCAGCTAGTAAATGG 0: 1
1: 3
2: 40
3: 277
4: 1252
908440182_908440184 -2 Left 908440182 1:64145871-64145893 CCTATTTTTGCTGATACAGAAGC 0: 1
1: 0
2: 1
3: 23
4: 218
Right 908440184 1:64145892-64145914 GCTGAGGCTGAGAAAGCCCCAGG 0: 1
1: 0
2: 1
3: 48
4: 383
908440182_908440185 -1 Left 908440182 1:64145871-64145893 CCTATTTTTGCTGATACAGAAGC 0: 1
1: 0
2: 1
3: 23
4: 218
Right 908440185 1:64145893-64145915 CTGAGGCTGAGAAAGCCCCAGGG 0: 1
1: 0
2: 3
3: 42
4: 348
908440182_908440190 22 Left 908440182 1:64145871-64145893 CCTATTTTTGCTGATACAGAAGC 0: 1
1: 0
2: 1
3: 23
4: 218
Right 908440190 1:64145916-64145938 TCATCCAGCTAGTAAATGGAAGG 0: 1
1: 1
2: 12
3: 56
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908440182 Original CRISPR GCTTCTGTATCAGCAAAAAT AGG (reversed) Intronic
904150873 1:28439162-28439184 GCTTAAGTATAAGCAAAACTAGG + Intronic
907686375 1:56615895-56615917 GCTGCTGGATGAACAAAAATTGG + Intronic
907814925 1:57908984-57909006 GCCTCTGTATCACGTAAAATAGG - Intronic
907928535 1:58977516-58977538 GCTTTGGTGTCAGCAAAAACAGG + Intergenic
908440182 1:64145871-64145893 GCTTCTGTATCAGCAAAAATAGG - Intronic
908672325 1:66562053-66562075 TCTTCTGTATCAGTTTAAATAGG + Intronic
908966076 1:69765194-69765216 ACTTACGTATCAGTAAAAATTGG - Intronic
910042729 1:82873079-82873101 TCTTCTGTATCAGCAGTATTTGG + Intergenic
910466680 1:87507705-87507727 GCTACTGTTTCAGCATAAAGTGG + Intergenic
913141538 1:115946189-115946211 GCTTCAGTATCTGCAAAATGGGG + Intergenic
913464503 1:119126059-119126081 AGTGCTGTATCAGCAAAAAATGG - Intronic
913479535 1:119274317-119274339 GAGTCTGTATCAGCAATAAATGG - Intergenic
914506510 1:148294605-148294627 GCTACTGTTTCAGCATAAAGTGG + Intergenic
914976441 1:152367962-152367984 CATTCTGTAGCAGCAATAATAGG + Intergenic
917920701 1:179747341-179747363 GCTGAGGGATCAGCAAAAATGGG - Intronic
920199541 1:204251063-204251085 GCTTGTGTCTAAACAAAAATTGG + Intronic
920217161 1:204369076-204369098 GCTGCTGTTTCAGCAAAACAGGG + Intronic
920569449 1:207005544-207005566 GCTTCTTTATCGGCAAAACTGGG - Intergenic
921184340 1:212656950-212656972 GTTTCCTCATCAGCAAAAATAGG - Intergenic
921221601 1:212977785-212977807 GCTTCTGATTCAGCACATATGGG + Intronic
923321017 1:232833217-232833239 GCTTCTGAAACAGAAAAAAAAGG - Intergenic
924319577 1:242835485-242835507 GCTTTTCTTACAGCAAAAATAGG + Intergenic
1063649448 10:7918584-7918606 GCTTCTATATCAGCAATAGGAGG - Intronic
1065361456 10:24893019-24893041 GATACTGTATGAGCAAAATTTGG - Intronic
1067171261 10:43908171-43908193 CCTACTGTATCACTAAAAATTGG + Intergenic
1067247995 10:44562255-44562277 ACTTCTCCAGCAGCAAAAATGGG + Intergenic
1068446557 10:57132246-57132268 TCTTCTGTATCAACCATAATTGG + Intergenic
1070113182 10:73504406-73504428 GCATGTGTATCAGCAAGAAGAGG - Intronic
1071062259 10:81586015-81586037 GCTTCTGCAAGAGCAAAAAATGG + Intergenic
1071560492 10:86643169-86643191 GATTCTGTCTCAAAAAAAATTGG - Intergenic
1072132677 10:92511442-92511464 GATTCTGTCTCCTCAAAAATAGG + Intronic
1075226638 10:120635168-120635190 GCTTCTTTATCAGAAAAATGGGG + Intergenic
1077657173 11:4030471-4030493 GTTTATGTAAAAGCAAAAATGGG - Intronic
1078689308 11:13562984-13563006 GCTTCTGGATCAGAGAAAAATGG + Intergenic
1081787897 11:45760656-45760678 GAGTCTATATCAGAAAAAATCGG + Intergenic
1082907640 11:58328121-58328143 CATACTGTATCAGCAAAAGTTGG - Intergenic
1086808381 11:91272272-91272294 GCCTCTGAAACAGCATAAATGGG + Intergenic
1087416414 11:97861904-97861926 GCTTCTGTAGCACCAAGACTGGG - Intergenic
1089948637 11:122504888-122504910 GATTCTTTATCTACAAAAATGGG + Intergenic
1089993963 11:122887202-122887224 GTTTCTTCATCAGTAAAAATGGG + Intronic
1091945327 12:4535283-4535305 GTTTCTGATTCAGCAGAAATGGG + Intronic
1092963677 12:13620665-13620687 GTTTCTGCATCTGTAAAAATAGG + Intronic
1094346667 12:29477394-29477416 TCTTCTGTATCAGAAACAAATGG + Exonic
1096744721 12:53718535-53718557 GATTCTGTCTCAGAAAAAAAAGG - Intronic
1097278336 12:57828109-57828131 ACATTTGTATTAGCAAAAATTGG - Intronic
1097870059 12:64594323-64594345 GATTCTGTCTCAGAAAAAAAAGG + Intergenic
1098408911 12:70158017-70158039 GATTTTAAATCAGCAAAAATAGG - Intergenic
1098708090 12:73717035-73717057 GTTTCTGCATCAGTAAAACTAGG - Intergenic
1101074115 12:101110288-101110310 GCGTCTGTATTGGGAAAAATGGG + Intronic
1101742800 12:107514098-107514120 GCTTCTGCATCAGCAAAGAGGGG - Intronic
1102181000 12:110912217-110912239 GCTTCTGTATGAGCAAGCAATGG - Intronic
1105781163 13:23706183-23706205 GCTTCTAAAACAGAAAAAATAGG + Intergenic
1106280695 13:28266529-28266551 GCTTCAGTATCAATAAAAATAGG - Intronic
1106895400 13:34294903-34294925 GCTTCTGTCTCTGCAAACACTGG + Intergenic
1108233367 13:48373966-48373988 ACTTCTTAATTAGCAAAAATGGG - Intronic
1108934225 13:55866399-55866421 GCTTCTGTATCCCCAATATTAGG + Intergenic
1111043245 13:82779399-82779421 CCTTCTGTATCATGAAAAATAGG - Intergenic
1111370866 13:87314582-87314604 GCCTCTGAATCAACAAAGATGGG + Intergenic
1111404524 13:87785317-87785339 GTTTCTGTATCAACAAACAAGGG + Intergenic
1115210090 14:30958685-30958707 GCTTCTGAAGAAGTAAAAATTGG + Intronic
1118111987 14:62732174-62732196 CCTTCTGTATCAGGAAAACTGGG + Intronic
1119679195 14:76579183-76579205 GTTTCTGTATCAGGTAAAAGGGG + Intergenic
1119685707 14:76629556-76629578 GGTTCTGTATCAGAACAAAATGG + Intergenic
1120244587 14:81992076-81992098 GTTTCTTCATCAGCAAAACTAGG - Intergenic
1121476291 14:94208506-94208528 GATTCTGTCGCATCAAAAATGGG - Exonic
1121674766 14:95743349-95743371 GCTTCTTCATCTGTAAAAATGGG - Intergenic
1122064359 14:99161572-99161594 GCTTCTCCATCAGTAAAAACAGG + Intergenic
1122064500 14:99162747-99162769 GTTTCCTTATCAGTAAAAATGGG - Intergenic
1124854437 15:33373394-33373416 GTTTCTGTATCAGTAAAATGGGG + Intronic
1125970897 15:43910838-43910860 GCTTCTCTATCTGTAATAATGGG - Intronic
1126119534 15:45239545-45239567 GCTGCTTTCTCAGGAAAAATTGG - Intergenic
1126343157 15:47665889-47665911 GTTTCTTCATCTGCAAAAATGGG - Intronic
1127326293 15:57898591-57898613 GCTTCTTCATCTGCAAAATTAGG - Intergenic
1129417721 15:75396632-75396654 GTTTCTTTATCAGCAAAATAGGG + Intronic
1129638367 15:77347371-77347393 GTTTCTGAATCAGAAAGAATCGG + Intronic
1131430378 15:92383413-92383435 GCACCTGTATCATCAAAACTTGG - Intergenic
1131966997 15:97854909-97854931 GCTTCTGAATCAACAAAGAAGGG + Intergenic
1135010208 16:18869661-18869683 GCATCTGTAGAAACAAAAATGGG - Intronic
1135317053 16:21456818-21456840 GCATCTGTAGAAACAAAAATGGG - Intergenic
1135369976 16:21889059-21889081 GCATCTGTAGAAACAAAAATGGG - Intergenic
1135441838 16:22482063-22482085 GCATCTGTAGAAACAAAAATGGG + Intronic
1136030241 16:27497443-27497465 GTTTGTCTATCTGCAAAAATGGG - Intronic
1136120564 16:28130525-28130547 GCTTCTGAGCCACCAAAAATTGG + Intronic
1136313874 16:29436989-29437011 GCATCTGTAGAAACAAAAATGGG - Intergenic
1136327314 16:29538754-29538776 GCATCTGTAGAAACAAAAATGGG - Intergenic
1136442002 16:30278740-30278762 GCATCTGTAGAAACAAAAATGGG - Intergenic
1139888803 16:70232471-70232493 GCATCTGTAGAAACAAAAATGGG - Intergenic
1141752503 16:85968266-85968288 GGTTCTGTTTCAGCAGAACTAGG + Intergenic
1145119800 17:20247970-20247992 GCTTCTGTTTCTGCCAGAATCGG + Intronic
1146024133 17:29304932-29304954 ACTTGTGTATAAGCAAAATTCGG + Intergenic
1146620248 17:34391568-34391590 CCTTCTGTATCAACTAAAATTGG + Intergenic
1148590867 17:48816021-48816043 GCTTCTGTATAAGTAAAATGGGG + Intronic
1150494682 17:65598068-65598090 TCTTCTGTGTGAACAAAAATAGG + Intronic
1153503218 18:5769573-5769595 GCTTCTTTACCTGTAAAAATTGG + Intergenic
1153654296 18:7269222-7269244 GCTTCTGAATCATCAATGATTGG - Intergenic
1153897998 18:9586647-9586669 GCTTCTGGATCATCAGTAATGGG - Intronic
1154359661 18:13648979-13649001 GCTTCTGTATTAGTAAATTTTGG - Exonic
1156065262 18:33135478-33135500 ACTTTTGTATCAGCAAAATCTGG - Intronic
1156910182 18:42402990-42403012 GCTTCTGGAGCAGGAAGAATAGG - Intergenic
1157054518 18:44210712-44210734 ACTTCTGAATCAACAAAGATGGG + Intergenic
1161060742 19:2213613-2213635 GAGGCTGTTTCAGCAAAAATTGG + Exonic
1162426458 19:10599513-10599535 GATTCTGTCTCAGAAAAAAAAGG + Intergenic
1164948921 19:32319796-32319818 GCTTCTTAATCAGCACATATTGG - Intergenic
1166770176 19:45277082-45277104 GATTCTGTCTCAGAAAAAAAAGG - Intronic
925737553 2:6977630-6977652 GCTCCTGTAACAGCAATAAAAGG - Intronic
927360910 2:22232044-22232066 GCTTTGGTATTAACAAAAATAGG - Intergenic
928222659 2:29417634-29417656 GCTATTTTATCAGTAAAAATAGG - Intronic
928417077 2:31104329-31104351 TCTTCTGTCTCTACAAAAATGGG - Intronic
930658986 2:54035134-54035156 GTTTCTTTTTCGGCAAAAATGGG + Intronic
932454136 2:71835432-71835454 CTTCCTGTATCAGCAAAATTTGG + Intergenic
932686309 2:73873442-73873464 GTTTCTGTATAAGCAAATTTAGG + Intronic
934523419 2:95033927-95033949 GTTTCTGCATCAGTAAAATTTGG + Intronic
937896719 2:126981680-126981702 GCCTCTGAGTCAGCAAACATTGG + Intergenic
937914288 2:127091397-127091419 GTTTCTGCATCGGCAAAGATGGG - Intronic
939523848 2:143266869-143266891 GCCCCTGTATCAGCCAAAATAGG + Intronic
941379266 2:164772273-164772295 GTTTCTTTATCAGCAAAATTTGG + Intronic
943572315 2:189587992-189588014 GCCTGTGTATCAGAAAAAAAGGG - Intergenic
945673411 2:212829264-212829286 GCTTCTATATCACCATAACTTGG + Intergenic
948217381 2:236241729-236241751 GCATCTGTATCATCACAAAGAGG - Intronic
1169839904 20:9923883-9923905 TCTTCTCTGTCAGCAAAAATGGG + Intergenic
1170196711 20:13696354-13696376 GTTTCTGTATCAGATAGAATGGG + Intergenic
1173953824 20:47015369-47015391 CCTTCTGCTTCAGCAAAACTCGG - Intronic
1176972080 21:15278272-15278294 TCTTCTGTACCAGCAAAGAGAGG + Intergenic
1177010233 21:15722941-15722963 GCTTCTGTTTCTGTAAAAAGAGG + Intergenic
1177187797 21:17817949-17817971 ATTTCTGTATTAGGAAAAATGGG + Intronic
1177608602 21:23416137-23416159 GCCTCTGTATCTACAAAATTTGG + Intergenic
1177609945 21:23433331-23433353 TCTTTTGTAGCAGCAAAAAATGG + Intergenic
1178445944 21:32642213-32642235 GCTTCATTACCAGCAGAAATGGG + Intronic
1178963462 21:37090645-37090667 GCATCAGTATCATTAAAAATTGG - Intronic
1180636678 22:17267405-17267427 GTTTCTTTAGCTGCAAAAATGGG + Intergenic
1181409293 22:22707030-22707052 TCTTCTGTATTAGCAGAAATTGG - Intergenic
1182088802 22:27580076-27580098 GGTTCTGTTTCAGCAGGAATGGG + Intergenic
1183340913 22:37280884-37280906 TCTTCTGTATCAGCAAGCTTTGG + Intergenic
1183658108 22:39202393-39202415 GATTCTGTCTCAAAAAAAATTGG + Intergenic
1183825415 22:40382841-40382863 GCTTCCCTATCAGTAAAATTAGG - Intronic
949478278 3:4469319-4469341 GCCACTGTATCAGCAAAATCAGG + Intergenic
950622208 3:14215008-14215030 GCTTCAGAATCAGCAAAACCTGG - Intergenic
950657300 3:14444635-14444657 GCTTGTGTGTCAGCAGAGATGGG + Intronic
950767726 3:15285891-15285913 GCTTCTGGATCAGCATAACTTGG + Intronic
950981781 3:17314932-17314954 TCTTCTGTATCAGAAAACTTTGG - Intronic
952006697 3:28849471-28849493 GATTCTGATTCAGCAAATATGGG - Intergenic
955120544 3:56053650-56053672 GCTTCCTTATCTACAAAAATGGG + Intronic
956813798 3:72889503-72889525 CCTTCTGTCTCAGTACAAATGGG + Intronic
958580689 3:96017489-96017511 GCTTCTACATCAGCAATACTGGG - Intergenic
959014527 3:101118503-101118525 GATTCTTTATCAGTAAAACTAGG - Intergenic
960165362 3:114395382-114395404 GCTTTTCTATCTGCAAAAAGAGG + Intronic
961614674 3:128169415-128169437 GCTTATCTTTCAGCAAAACTGGG - Intronic
962827002 3:139107647-139107669 CCTTCTCTATCAGCAGAAAGGGG - Intronic
963960033 3:151299485-151299507 GACTCTGTATCAGAAAAAAAAGG - Intronic
964731228 3:159867435-159867457 GATTCTAAATCAGCAAAAATCGG + Intronic
964793632 3:160475348-160475370 ATGTCTGCATCAGCAAAAATAGG + Intronic
965354236 3:167654587-167654609 GCTTCTTTATCAGTAAAATGGGG - Intergenic
966936580 3:184713726-184713748 GCTACAGTATCAGAAAAAAGTGG - Intergenic
967704025 3:192629480-192629502 ACTTCTGCATCTGCAAAAATGGG + Intronic
967823403 3:193859244-193859266 GCTTCTGTATCTATAAAACTAGG - Intergenic
969042044 4:4306778-4306800 CCTTCTGTTTCAGAAAGAATAGG - Intronic
970365418 4:15353505-15353527 GCTTGTGTATCAGACCAAATCGG + Intronic
970453843 4:16201813-16201835 GCTTCCCCATCAGCAAAAAGGGG - Intronic
970636561 4:18016899-18016921 GCTTCTGTATCATAAAAATCAGG + Intronic
972099854 4:35401277-35401299 ATTTCTGTATCAGTAAACATTGG - Intergenic
972809807 4:42570694-42570716 GCTTCTGGAGCAGCAATAACAGG - Intronic
974386809 4:61211257-61211279 ACTTAGGTATCAGGAAAAATTGG + Intronic
978118128 4:105047064-105047086 GCTTGAGAATCAGGAAAAATAGG + Intergenic
980461345 4:133118510-133118532 TCTTCTGTAGCAGCAAATATAGG - Intergenic
981497851 4:145413610-145413632 GATTCTGGATCAGCAAATTTTGG + Intergenic
981915002 4:150024014-150024036 GCTTCTGTAGCAGAAATAGTTGG - Intergenic
982361307 4:154522491-154522513 GATCCTGTATCACCAAAAATGGG + Intergenic
983147000 4:164229000-164229022 GCGTCTGTATTAGCGAAAATTGG + Intronic
984189278 4:176585526-176585548 GACTCTGTATCAGAAAAACTGGG - Intergenic
985421213 4:189786726-189786748 GCTTCTATAACTGCAAAGATAGG + Intergenic
985499095 5:230088-230110 GCGTCTGTATCTCCAAAAAAAGG + Intronic
986840348 5:11689247-11689269 GTTTCTTAATCTGCAAAAATGGG + Intronic
989025051 5:37058161-37058183 GATTCTGTTTCAGCAAATCTGGG - Intronic
989736364 5:44712049-44712071 GATTCTGTAGCATCCAAAATTGG - Intergenic
993511921 5:88781422-88781444 GCTTCTGAAGCAGTAAAAAAGGG - Intronic
993769796 5:91913050-91913072 GTTTCCTTATCTGCAAAAATGGG - Intergenic
995429505 5:112058517-112058539 GCTTCTGTTTCAGCAGAGCTGGG - Intergenic
997918035 5:137948820-137948842 GTTTCTGAATCTGCAAAGATGGG + Intronic
999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG + Intronic
999847222 5:155497336-155497358 CCCTCTGTTTCAGCAATAATAGG + Intergenic
999875866 5:155805092-155805114 GCTACTGTATTAGAAAATATGGG + Intergenic
1000695568 5:164377181-164377203 GTTTCTATACCAGCAAAAATTGG + Intergenic
1000742675 5:164988872-164988894 GTTTCTTTATCAGCAAAATAGGG - Intergenic
1004496535 6:16168655-16168677 GATTTTGTATCAGCAAGAAGTGG - Intergenic
1004837792 6:19547699-19547721 TCCCCTGTATCAGCAAAAATAGG + Intergenic
1005106274 6:22227641-22227663 GCTTCTATATTAGGCAAAATAGG + Intergenic
1006292412 6:33149431-33149453 GCTTCTGTATCTGCTAAAATTGG - Intergenic
1009028850 6:58032868-58032890 GATTCTGAATCACCAAAATTAGG - Intergenic
1009204384 6:60784248-60784270 GATTCTGAATCACCAAAATTAGG - Intergenic
1011131094 6:84052413-84052435 GCTTATGTTTCAGCAAAGCTTGG + Intronic
1012293687 6:97493068-97493090 GTTTCTTTATCTGTAAAAATTGG - Intergenic
1013917321 6:115356603-115356625 ACTTCTTTATCTCCAAAAATGGG + Intergenic
1014331606 6:120073934-120073956 GCTCATGTATAAGCAGAAATAGG - Intergenic
1017367153 6:153656597-153656619 CTTTTTCTATCAGCAAAAATAGG - Intergenic
1018607929 6:165618085-165618107 GCTTCTCTGACAGCAAAAATAGG + Intronic
1019573890 7:1726864-1726886 GCTCCTGTCTCAGCAGACATGGG - Intronic
1022018911 7:26379229-26379251 GCTTCTTTATCAGCAGAAGAAGG - Intergenic
1022270349 7:28801078-28801100 CCTTCTATATCTGCAAAAATAGG - Intronic
1022298554 7:29080922-29080944 TCTTCTCCATCAGCAAAAACGGG - Intronic
1023329919 7:39104019-39104041 CCTTCTGAATGAGCAAAACTGGG + Intronic
1023392894 7:39727569-39727591 TCTTCTGTAACAGCATGAATGGG - Intergenic
1023631912 7:42173487-42173509 GCTTCTAAATCAGAATAAATGGG - Intronic
1024676140 7:51639384-51639406 GCTTCTGCATCAGAAAAACCTGG - Intergenic
1027379513 7:77591665-77591687 GTTTCTTTATCTGTAAAAATAGG - Intronic
1027512235 7:79097370-79097392 GTTTCAGTAACAGCAAAAAATGG - Intronic
1028341703 7:89730345-89730367 GCTTTTGAATAAGAAAAAATTGG + Intergenic
1028660490 7:93267086-93267108 GCTTCTCTATCAAAACAAATGGG - Intronic
1029725952 7:102404585-102404607 GGTTTTGTTGCAGCAAAAATTGG + Exonic
1029903820 7:104070828-104070850 GCTCCTGCATCAGAAAATATAGG - Intergenic
1030382576 7:108829171-108829193 TTCTCTGTATCTGCAAAAATGGG + Intergenic
1030713152 7:112777305-112777327 GTTTCTGTAGAAGAAAAAATTGG - Intronic
1031309137 7:120172641-120172663 GGTTCTGTCTCAGGAACAATAGG - Intergenic
1031464530 7:122092386-122092408 GCATCTGTTTCTCCAAAAATTGG + Intronic
1033762788 7:144454424-144454446 GCTCCTGTATCAGCAAAGAGAGG - Intronic
1033851336 7:145499193-145499215 GCTTCAGGATCAGCATAATTAGG + Intergenic
1035685797 8:1522673-1522695 GCTTCTTTTTCAGCAGAAAGAGG + Intronic
1035725093 8:1819344-1819366 AGTTATGTATCAGCAAAAAGGGG - Intergenic
1037461107 8:19110364-19110386 GTTTCAGTAGCAGCAAAAACAGG - Intergenic
1038098395 8:24342566-24342588 GCATATGTTTCAGGAAAAATGGG - Intronic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1038750197 8:30287465-30287487 GACTCTGTATCAGAAAAAAAGGG + Intergenic
1040122520 8:43699070-43699092 GCTGCTTTCTCAGGAAAAATTGG - Intergenic
1045316133 8:101045171-101045193 GCCTCTGTAACAGGCAAAATGGG + Intergenic
1045803750 8:106132393-106132415 ACTTCTGTATTATCAAAAGTGGG - Intergenic
1046198361 8:110891568-110891590 GTTTCTCTATCAACAAATATTGG + Intergenic
1047697493 8:127417368-127417390 GGTTTTGTATCAGGACAAATAGG - Exonic
1050077186 9:1877499-1877521 GTTTCTTTATCAGAAAAAAGTGG - Intergenic
1051552490 9:18345759-18345781 GCTTCTGTAGCAGCCACCATGGG + Intergenic
1052416823 9:28188562-28188584 TCTTCTCTATCACCAAAAATTGG + Intronic
1052586782 9:30439496-30439518 AATCCTGTATCAGGAAAAATGGG + Intergenic
1052660759 9:31427246-31427268 GGTTGTGAATCAGCAAAAATTGG - Intergenic
1055778142 9:79788813-79788835 ACTTCTATAACAGCAAAAAATGG - Intergenic
1056938924 9:90938476-90938498 GCTTCTGAAGCAGCAACCATAGG + Intergenic
1058283404 9:103146422-103146444 CCTTCAGCCTCAGCAAAAATAGG - Intergenic
1186387878 X:9128224-9128246 GCATCTGAATCAGCAGAAAGGGG + Intronic
1189357058 X:40317999-40318021 GCTTCTATATTAAGAAAAATGGG + Intergenic
1189602242 X:42639687-42639709 GCTTCTGTGTCAGTGATAATGGG + Intergenic
1191085150 X:56558683-56558705 GTTTCTTCATCAGCAAAAGTGGG - Intergenic
1195471306 X:105233366-105233388 TATTCTGTATCAGGAAATATTGG + Intronic
1195888145 X:109663050-109663072 GCTTCTCCATCAGCAAAACAAGG - Intronic
1198769343 X:140112377-140112399 GCTTCAGAATCAGAAAAACTAGG - Intergenic
1199417503 X:147602416-147602438 GCTTCTGTGTCAACAAATACTGG + Intergenic
1199440267 X:147859848-147859870 GCTTCTCTCTCAGCAAACTTTGG + Intergenic