ID: 908441252

View in Genome Browser
Species Human (GRCh38)
Location 1:64156922-64156944
Sequence GCTGCTAGTAAGTCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908441252 Original CRISPR GCTGCTAGTAAGTCAAAAGC TGG (reversed) Intronic
901955446 1:12781793-12781815 GCTGCTACCAAAACAAAAGCTGG - Intergenic
901978809 1:13017844-13017866 GCTGCTACCAAAACAAAAGCTGG - Intronic
902003272 1:13211094-13211116 GCTGCTACCAAAACAAAAGCTGG + Intergenic
902022495 1:13356845-13356867 GCTGCTACCAAAACAAAAGCTGG + Intergenic
903261706 1:22135097-22135119 GCTGCTAGGACATCAAGAGCTGG + Intronic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904169536 1:28581832-28581854 GCAGCTAGTAAGTCGACACCGGG + Intergenic
905175132 1:36130641-36130663 GCTGCTGGCAACTCAAAAGAAGG - Intergenic
905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG + Intergenic
906032199 1:42730601-42730623 GCTGCTCGGAAGTCTCAAGCAGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
912464127 1:109857975-109857997 GCTACTAATTAGGCAAAAGCAGG - Intergenic
917669848 1:177263128-177263150 GATGCTAGAAAGTGAAAAGTTGG + Intronic
919194632 1:194267347-194267369 GCAGTCAGTAAATCAAAAGCTGG + Intergenic
919258922 1:195163655-195163677 GCAGTTATTAAGGCAAAAGCTGG - Intergenic
919840702 1:201607225-201607247 GCTGCTTGGAAGTCTAAGGCAGG - Intergenic
921561918 1:216669328-216669350 GGTTCCAGTAAGTCAAAACCAGG + Intronic
1065263762 10:23954176-23954198 TCTTCTAGTAAGTCAATAGACGG + Intronic
1069353151 10:67553548-67553570 GCTGCTAATAAGTAAAATGCAGG - Intronic
1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG + Intergenic
1079243152 11:18734949-18734971 ACTGCTAGTAAGTCAGAATCAGG - Intronic
1080647903 11:34200103-34200125 GCTGCTAATAAGTTGAAACCTGG + Intronic
1086013680 11:82137793-82137815 GCTGCTAGGGAGGCAAAAGATGG + Intergenic
1090254812 11:125276116-125276138 GCTGCTGGGAAGTCAAAATGAGG + Intronic
1092066784 12:5597008-5597030 CCAGCTAGTTGGTCAAAAGCTGG + Intronic
1100241617 12:92715265-92715287 GCTGCCAGCAAATCTAAAGCAGG - Intergenic
1101419880 12:104541986-104542008 GTTGCTAGAAAGTAAAATGCAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1108539149 13:51420936-51420958 GGTTCTACTAACTCAAAAGCTGG + Intronic
1110866438 13:80401240-80401262 GCGGAAAGTATGTCAAAAGCAGG - Intergenic
1112043575 13:95572896-95572918 GGTGCCAGGAAGACAAAAGCAGG + Intronic
1117982851 14:61358872-61358894 GGAGTTACTAAGTCAAAAGCAGG - Intronic
1118686676 14:68298397-68298419 GGTGCTAGTTTGTCAAAAGGAGG + Intronic
1119227784 14:72957098-72957120 GCTACTCGGAAGTCAGAAGCAGG + Intronic
1122567944 14:102675464-102675486 GCTGTTAGTAAGTAAAATACAGG + Intronic
1122999386 14:105284292-105284314 TCTACTAGTAAGTCCACAGCAGG + Intronic
1126299576 15:47181197-47181219 ACTGCTAGTAAGTAAGAAGGAGG - Intergenic
1130455994 15:84108918-84108940 TCTGCTAGTAAGCCACAAGGTGG + Intergenic
1134863902 16:17587211-17587233 GCAGCCACTAACTCAAAAGCTGG + Intergenic
1138940231 16:61781507-61781529 GATGCTAGGGAGTCTAAAGCAGG + Intronic
1139065797 16:63312498-63312520 GGGGATAGGAAGTCAAAAGCTGG + Intergenic
1139177669 16:64709203-64709225 GCTGCTAGAATGCCAATAGCTGG + Intergenic
1140296397 16:73713197-73713219 GCTGGTAGTGAGTTAAAAGTAGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1159837407 18:73355232-73355254 GTTGCTAGTGAGTCAAAGGGTGG + Intergenic
1160191422 18:76717279-76717301 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1160261222 18:77295979-77296001 GCTGCAAGCAAGGCAAAACCAGG + Intergenic
1162288699 19:9761769-9761791 GCTGGTAGTAAGCAAAAAGATGG + Intronic
1163409526 19:17145375-17145397 CCTGCAAGGAAATCAAAAGCAGG - Exonic
1166529444 19:43533880-43533902 ACTGAGACTAAGTCAAAAGCCGG + Exonic
1167698296 19:51027441-51027463 GCAGCCAGTAAGTGAACAGCTGG - Exonic
925697772 2:6599446-6599468 GGAGATAGTAAGACAAAAGCGGG + Intergenic
928877237 2:36054225-36054247 GCTGCTGGTATGGCAAAACCAGG + Intergenic
932121010 2:69100194-69100216 TCTGCCAGTAAGTGAAAACCAGG - Intronic
932360494 2:71101691-71101713 CATCCTAGTACGTCAAAAGCTGG + Intergenic
934741064 2:96722906-96722928 GCTGCTTGGAAGTCTGAAGCAGG + Intronic
934900161 2:98153662-98153684 GCTGCCAGTAAGCCATAAACAGG - Intronic
936594665 2:113836407-113836429 GTAGCTAGTAAGTGAAGAGCTGG - Intergenic
937599960 2:123719680-123719702 GCGGCTTGTAAGTCATAAGTAGG - Intergenic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
1171963407 20:31512125-31512147 GCTGGTAGTAAGCCTAAAGTGGG + Intergenic
1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG + Intronic
1174876319 20:54230373-54230395 GCTGCTATTAATGCAAAACCAGG + Intergenic
1175777878 20:61664324-61664346 GCTAGTTTTAAGTCAAAAGCAGG + Intronic
1176525370 21:7862595-7862617 GCTGATTACAAGTCAAAAGCAGG - Intergenic
1177198739 21:17930326-17930348 GCTGCTAATAAGATGAAAGCAGG - Intronic
1178659390 21:34492608-34492630 GCTGATTACAAGTCAAAAGCAGG - Intergenic
1180630266 22:17224514-17224536 GCTGAAGGTAAGTCCAAAGCAGG + Intergenic
1183259017 22:36782258-36782280 GCAGCAAATAAGTCAAAAGGCGG - Intergenic
1184912017 22:47541887-47541909 GGTACTAGTAAGTCAAAGACGGG + Intergenic
950396348 3:12736988-12737010 GCTGCTTGTGAGGCTAAAGCAGG - Intronic
950899712 3:16486560-16486582 GCTGTTAGTCAGGCAAAAGATGG - Intronic
952144801 3:30520245-30520267 CCTGCAAGTAGGTAAAAAGCAGG - Intergenic
956850689 3:73225548-73225570 GCTGCATGTAAGTGAAAACCAGG - Intergenic
960108023 3:113818875-113818897 CCTGCTTGTAAGTCAAAAATCGG + Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
975608947 4:76184914-76184936 GCAGCTTGGAAGACAAAAGCAGG - Intronic
976165226 4:82247547-82247569 GATCCTATAAAGTCAAAAGCAGG - Intergenic
978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG + Intergenic
982174502 4:152692995-152693017 GCTGCTAGTGAGTCTGAGGCAGG + Intronic
989546195 5:42676706-42676728 GCTGCTAGTATATCAAAATATGG - Intronic
992029195 5:72703595-72703617 TCTGCTATTTAGTCAAAATCAGG + Intergenic
992110306 5:73486611-73486633 GCTACTTGTAAGGCCAAAGCAGG - Intergenic
993839897 5:92865445-92865467 GATGCCCGTAAGTCAAAACCAGG - Intergenic
997897830 5:137735802-137735824 GCTGCGAGTAAGTCAGAGGAAGG - Exonic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1000012564 5:157246245-157246267 GCTGCTGTGAAGTCAAAAGCTGG + Intronic
1001859384 5:175040142-175040164 GCTGCTATTAAGTTGAAAGAGGG - Intergenic
1006996813 6:38268795-38268817 GCTGGTAGTAAGTCTGAAGGAGG - Intronic
1007571950 6:42899171-42899193 GCTGCTACCAAAACAAAAGCTGG - Intergenic
1011650226 6:89499356-89499378 GCTGCAAGTAACAAAAAAGCAGG - Intronic
1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG + Intergenic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1015445355 6:133297567-133297589 GGTGTTAGTAAGGCAAAACCAGG - Intronic
1020010982 7:4805638-4805660 GCTGGTAGTGAGTCAGCAGCCGG + Exonic
1031065185 7:117097149-117097171 GTTGCTAGGCAGTCAACAGCAGG + Intronic
1034519813 7:151611121-151611143 TCTGCTTTTAAGTCAAAAGAAGG + Intronic
1034590509 7:152134165-152134187 GCTGCCAGTAACTGAAAGGCAGG - Intergenic
1036903765 8:12690859-12690881 CCTGCCAGTAAGGCAAAAACAGG - Intergenic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1049524641 8:143117079-143117101 GCAGAGAGTAAGTGAAAAGCAGG + Intergenic
1051008936 9:12385962-12385984 GATACTAGTAAGTTAAAAACAGG + Intergenic
1052597340 9:30576323-30576345 GCTCCTAGAAAGGCTAAAGCAGG - Intergenic
1052737018 9:32353057-32353079 GCTGCCAGTGAATCTAAAGCAGG - Intergenic
1055490047 9:76795522-76795544 GCTATTAGTAACTCAAAATCAGG - Intronic
1056313922 9:85370415-85370437 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG + Intronic
1058702199 9:107610583-107610605 GCTGCCAGTAAATCTAAAGGAGG - Intergenic
1187895838 X:23978729-23978751 GCTGCTAGCAACTCAAGAACAGG + Intergenic
1188747199 X:33860558-33860580 TATGCTAGTAAGTGAAAAGAAGG + Intergenic
1194948431 X:100095715-100095737 GCTGCTTGGAAGGCTAAAGCAGG + Intergenic
1197386819 X:125812596-125812618 GCTGCCAGTAAATATAAAGCAGG + Intergenic
1200567817 Y:4788662-4788684 GCTACTAGGAAGTCTGAAGCAGG - Intergenic