ID: 908443340

View in Genome Browser
Species Human (GRCh38)
Location 1:64177561-64177583
Sequence GGGGTTGTTATAGTCTTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908443340_908443347 17 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 908443340 1:64177561-64177583 CCTTGAAAGACTATAACAACCCC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 908443347 1:64177601-64177623 TCAACAAGAAGCCTCCCTAATGG 0: 1
1: 0
2: 0
3: 5
4: 88
908443340_908443342 -10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 908443340 1:64177561-64177583 CCTTGAAAGACTATAACAACCCC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 908443342 1:64177574-64177596 TAACAACCCCCAGCAATGGACGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908443340 Original CRISPR GGGGTTGTTATAGTCTTTCA AGG (reversed) Exonic
905426964 1:37893558-37893580 GAGGCTTTTATAGTCATTCAGGG - Intronic
907750644 1:57260006-57260028 GGGGTTCTTAAAGTCTTCTAAGG - Intronic
907984494 1:59517197-59517219 CAGGTTGTTATTGCCTTTCAGGG - Intronic
908074457 1:60499186-60499208 GGGGTAGCTATACTCTTTTAAGG + Intergenic
908443340 1:64177561-64177583 GGGGTTGTTATAGTCTTTCAAGG - Exonic
917766530 1:178225340-178225362 TGTGTTGTTATTTTCTTTCAGGG - Intronic
917856515 1:179105334-179105356 GGGATTGTAATTGTTTTTCAGGG - Exonic
919812781 1:201419661-201419683 GGGGTTGGGATAGTGCTTCATGG - Intronic
921285468 1:213605500-213605522 GGGGTCGTTTAAGTCTTTGAGGG - Intergenic
923890988 1:238214667-238214689 GGGCATGTTAAAGACTTTCATGG - Intergenic
1066403180 10:35094666-35094688 GGGGCTGTTATAGTGATTCATGG - Intergenic
1069728815 10:70598344-70598366 GGGGTTGTTATTGTCCCACACGG + Exonic
1075685122 10:124358827-124358849 TGGGTTTTTATTTTCTTTCATGG - Intergenic
1085720691 11:78909964-78909986 GGGGTTCTTATAGCCTGTCCCGG - Intronic
1086161484 11:83726860-83726882 GGGGTCATTATTGTCTTTCTAGG - Intronic
1087622844 11:100562507-100562529 GTGGGTGTTATTGCCTTTCATGG + Intergenic
1093153484 12:15651781-15651803 CAGATTGTTATAGACTTTCATGG + Intronic
1093964047 12:25306733-25306755 GTTGTTGTTATATTCTTTCCTGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098068009 12:66640763-66640785 GGTTTTGTCATAATCTTTCAAGG + Intronic
1098337607 12:69420070-69420092 TGGGTTGTCATTGTCTTTGAGGG + Intergenic
1099206307 12:79731792-79731814 TGAGTTGTGATAGTTTTTCAAGG - Intergenic
1103762527 12:123261953-123261975 GGGATTGTTAGCGTCCTTCAGGG - Intronic
1116070512 14:40038760-40038782 GAGGTTGGTATAGTCTCTAAAGG + Intergenic
1116661758 14:47718707-47718729 AGGGATTTTATAGTATTTCATGG + Intergenic
1117160772 14:52987216-52987238 GGGGTTGTTATGGTGTGACAGGG + Intergenic
1117959834 14:61151956-61151978 GAAGTTGATATAGTCTTTCCAGG - Intergenic
1118024904 14:61759212-61759234 AGGGTTGTTATCTACTTTCAAGG - Intergenic
1118570737 14:67192308-67192330 AGGGTTGTTATGGGCTATCATGG - Intronic
1124187859 15:27545506-27545528 GGGCTTATTATAGTCATTGAAGG - Intergenic
1125475430 15:40044946-40044968 AGGGTTGTTGTCGGCTTTCAAGG + Intergenic
1128675615 15:69606499-69606521 GGAGTTTCTATAGTATTTCAAGG - Intergenic
1131925564 15:97379609-97379631 AGGATTGTCATAGACTTTCAAGG - Intergenic
1133613579 16:7455403-7455425 GGAGCTGTTATATTCTTGCATGG - Intronic
1137242826 16:46672602-46672624 GAGGTTGTTATAGTCTTCTGTGG - Intronic
1140277778 16:73526229-73526251 TGGGCTGATATATTCTTTCAAGG + Intergenic
1141907171 16:87034536-87034558 GATGTGGATATAGTCTTTCAAGG - Intergenic
1142078967 16:88137738-88137760 GGGGTTATTGTAGTCTTTAGAGG + Intergenic
1152462546 17:80449181-80449203 GGGGTTGGAAAAGTCTTTCAAGG + Intergenic
1156950163 18:42886494-42886516 AGGTTTCTTATAGTCTTTCATGG + Intronic
1157920265 18:51707103-51707125 GAGATTGTTTTAGGCTTTCATGG - Intergenic
1158089272 18:53691757-53691779 GGGGTTGTTATAGAATTTGAGGG - Intergenic
1164410522 19:28001043-28001065 AGGATGGTTTTAGTCTTTCAGGG + Intergenic
925519831 2:4731274-4731296 GGGATTGTCATTGTTTTTCATGG + Intergenic
925792700 2:7508758-7508780 GGGGAAGTTATAGGCTTACAGGG - Intergenic
926738435 2:16091627-16091649 GGTTTTGTTTCAGTCTTTCAAGG + Intergenic
926934910 2:18077173-18077195 GGGGTTGATATAACCTGTCAAGG + Intronic
929341712 2:40826899-40826921 GGGTTTGTAATAGCTTTTCATGG + Intergenic
933566924 2:83961823-83961845 CAGGTTGTTCTAGTCTTTTAGGG - Intergenic
934687987 2:96335610-96335632 GGGGTTTTCATACTATTTCAGGG + Intergenic
941399627 2:165014844-165014866 GGTGGTGTTATGGTCTTTTAAGG - Intergenic
941703478 2:168632064-168632086 GTGGCTGCTATAGTCTTTCCAGG + Intronic
942692547 2:178601497-178601519 GGGGTAGTTGCAGACTTTCATGG - Exonic
943461691 2:188176931-188176953 AGGGTTCTTTTAGTCTTTGAAGG - Intergenic
945732355 2:213554180-213554202 AGTGTTGTTAGAGTCTTTGATGG - Intronic
946660887 2:221998252-221998274 GGCATTGTTTTAGGCTTTCAGGG + Intergenic
1171235501 20:23521027-23521049 GGCCTTGTTATACTCCTTCATGG - Intergenic
1179794812 21:43776553-43776575 GGGGCTGGTATCGTCTTTCCGGG + Intergenic
1182681951 22:32086345-32086367 GAGGTTGGTAGAGTCTTTCTTGG + Intronic
1182979582 22:34656265-34656287 GGGATTGTTATAATGTTACATGG + Intergenic
1183276814 22:36903642-36903664 GAGACTGTTATAGTCTTGCAGGG - Intergenic
949101650 3:152677-152699 GTGTTTATTATAATCTTTCAAGG - Intergenic
949615551 3:5750006-5750028 GTGGTTTTTATAGTTATTCAAGG + Intergenic
950482018 3:13250134-13250156 GGGCTTGTCACAGGCTTTCAGGG + Intergenic
950776828 3:15357287-15357309 GGTGTAGTTATAGTGTTTCTGGG + Intergenic
952042329 3:29276130-29276152 AGGTTTGATATTGTCTTTCAAGG + Intergenic
952924402 3:38310585-38310607 GGGGCTATTATAGTCTCTCAGGG + Intronic
955982993 3:64545941-64545963 GGGGCTGTGACAGTCTTCCAGGG + Intronic
956045672 3:65193437-65193459 GGGTTTGTTATTGATTTTCAGGG + Intergenic
958988073 3:100806459-100806481 TGGATTTTTATAGTCTTTCAAGG - Intronic
962597097 3:136957315-136957337 AGGGTGGTTAAAGTCCTTCAAGG + Intronic
965776192 3:172233875-172233897 GGGGTTGGTATTGTGTTCCATGG + Intronic
969206285 4:5649065-5649087 GGGATTGTTAGGGACTTTCAGGG - Intronic
969666812 4:8562524-8562546 GTTGCTGTTATTGTCTTTCAAGG + Intronic
970199060 4:13583506-13583528 GGTTTTGATATAGCCTTTCAGGG + Intronic
970922450 4:21410960-21410982 GGGTCTATTTTAGTCTTTCAAGG + Intronic
971871599 4:32247292-32247314 AGGGTTATTATAGTTTTTCTTGG - Intergenic
978647915 4:110962747-110962769 GGCGATATTATAGTCATTCATGG + Intergenic
980671161 4:136008760-136008782 GGGGTTTTTATGGTCTTTAGAGG - Intergenic
981598391 4:146454351-146454373 GGGATTGTCATAGTATTTAATGG - Intronic
982091365 4:151882839-151882861 TGGGTTGTTATTGCCTCTCAGGG - Intergenic
984217450 4:176931992-176932014 TGGATTGTTATATTTTTTCATGG + Intergenic
985440470 4:189980040-189980062 GGGCTTGGTTTAGTCTTGCAGGG - Intergenic
986420586 5:7577171-7577193 GTGGTTGTTAAAGTATTCCAGGG + Intronic
986575285 5:9205999-9206021 GGGGATGTTAGAGTCTTGCCAGG + Intronic
987201075 5:15578921-15578943 TGGACTGTTTTAGTCTTTCATGG + Intronic
989680291 5:44020834-44020856 GGGGGTTTTATAATTTTTCATGG + Intergenic
991238715 5:64431060-64431082 AAGGTTGATTTAGTCTTTCAGGG - Intergenic
995483419 5:112614998-112615020 GGGTTTGTTATAGTTTCCCATGG + Intergenic
995691003 5:114825560-114825582 GGGCATGTTAGAGACTTTCATGG - Intergenic
995737386 5:115316268-115316290 GGTGTTGTTATAGGCTTGCGAGG - Intergenic
995983093 5:118132086-118132108 GTGGTTATAATATTCTTTCATGG + Intergenic
999541034 5:152572913-152572935 GGGCATGTTAGAGACTTTCATGG + Intergenic
1001429080 5:171645404-171645426 GTGGTTGACATGGTCTTTCAAGG + Intergenic
1001801508 5:174548260-174548282 GGGGCTGTTATATTTTTGCAGGG - Intergenic
1005213742 6:23500442-23500464 TGGCTTGGTATATTCTTTCATGG - Intergenic
1006153357 6:32001132-32001154 GGGGTTGTAGTAGTCGTACAGGG - Exonic
1006159665 6:32033869-32033891 GGGGTTGTAGTAGTCGTACAGGG - Exonic
1007957989 6:45934457-45934479 TGGATGGTTTTAGTCTTTCAAGG - Intronic
1008492498 6:52101036-52101058 TGGGTTATCATAGTATTTCATGG + Intergenic
1009997523 6:70912961-70912983 GTGTTTGTAATAGTCTTTTAAGG + Intronic
1010375136 6:75159929-75159951 GAGGTTGTTAAAGTATATCAAGG - Intronic
1011416079 6:87121637-87121659 GGCGTTGTTATTGTCTTGGATGG - Intergenic
1014083048 6:117310230-117310252 TGGACTGGTATAGTCTTTCACGG + Exonic
1015625177 6:135174134-135174156 GGGGCTGTTATGGTAGTTCAGGG + Intergenic
1019178104 6:170170926-170170948 GGGGTTGTTATAGCCTGTTTGGG + Intergenic
1025747844 7:64260200-64260222 GTTGTTGTTATTGTTTTTCAGGG + Exonic
1027642718 7:80757113-80757135 AGGGTTGTTACAATCTGTCAAGG + Intronic
1028495733 7:91457910-91457932 GGGTTTTTTTTAGTCTTCCATGG - Intergenic
1028734369 7:94190636-94190658 GTGGTTGTTATAGTCATTCCTGG - Intergenic
1031883190 7:127219779-127219801 GGGGTGGGTATAGTGGTTCATGG - Intronic
1036915428 8:12799623-12799645 GGGGTTTTTATGGTCTTTAGAGG + Intergenic
1045133410 8:99184414-99184436 GGGGTTGAAATAGTATCTCATGG + Intronic
1047446079 8:124920911-124920933 GGGGTTGATCCAGTATTTCAGGG - Intergenic
1050607545 9:7317227-7317249 CGGGTTGGTATAGTGTTTGATGG - Intergenic
1052818495 9:33120529-33120551 GGTGTAGTCATAGTCCTTCAAGG + Exonic
1056802076 9:89699179-89699201 GGGGATGCTATAGTCTTTTGGGG + Intergenic
1059693809 9:116711852-116711874 GGAGTTGTAGTAGTGTTTCAAGG - Intronic
1062608695 9:137361999-137362021 TTGGTTGTTTTTGTCTTTCAGGG - Intronic
1193924744 X:87470271-87470293 GTTGTTGTTATATTCTTTCCTGG - Intergenic
1197918188 X:131558732-131558754 TGAGGTGTTAGAGTCTTTCAAGG - Intergenic
1199928378 X:152493825-152493847 GGGCATGTTAGAGACTTTCATGG + Intergenic
1201344137 Y:12964875-12964897 GGGGCTGTTGTAGGCTTTCCTGG + Intergenic
1201543512 Y:15134787-15134809 CGGGTTGTTAAAGTCTTTTATGG - Intergenic