ID: 908445441

View in Genome Browser
Species Human (GRCh38)
Location 1:64195556-64195578
Sequence CATGAGAGGGATTCCGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908445441_908445445 2 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445445 1:64195581-64195603 TTGAGTCACTGACTTCAGGAAGG No data
908445441_908445444 -2 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445444 1:64195577-64195599 TGCTTTGAGTCACTGACTTCAGG No data
908445441_908445448 21 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445448 1:64195600-64195622 AAGGGCCTAGTCCCATTTAAGGG No data
908445441_908445446 3 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445446 1:64195582-64195604 TGAGTCACTGACTTCAGGAAGGG No data
908445441_908445447 20 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445447 1:64195599-64195621 GAAGGGCCTAGTCCCATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908445441 Original CRISPR CATGAGAGGGATTCCGTGTA AGG (reversed) Intergenic
No off target data available for this crispr