ID: 908445445

View in Genome Browser
Species Human (GRCh38)
Location 1:64195581-64195603
Sequence TTGAGTCACTGACTTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908445438_908445445 25 Left 908445438 1:64195533-64195555 CCAAGCTAGAAACAGACAGTCTC No data
Right 908445445 1:64195581-64195603 TTGAGTCACTGACTTCAGGAAGG No data
908445440_908445445 3 Left 908445440 1:64195555-64195577 CCCTTACACGGAATCCCTCTCAT No data
Right 908445445 1:64195581-64195603 TTGAGTCACTGACTTCAGGAAGG No data
908445441_908445445 2 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445445 1:64195581-64195603 TTGAGTCACTGACTTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908445445 Original CRISPR TTGAGTCACTGACTTCAGGA AGG Intergenic
No off target data available for this crispr