ID: 908445446

View in Genome Browser
Species Human (GRCh38)
Location 1:64195582-64195604
Sequence TGAGTCACTGACTTCAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908445441_908445446 3 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445446 1:64195582-64195604 TGAGTCACTGACTTCAGGAAGGG No data
908445440_908445446 4 Left 908445440 1:64195555-64195577 CCCTTACACGGAATCCCTCTCAT No data
Right 908445446 1:64195582-64195604 TGAGTCACTGACTTCAGGAAGGG No data
908445438_908445446 26 Left 908445438 1:64195533-64195555 CCAAGCTAGAAACAGACAGTCTC No data
Right 908445446 1:64195582-64195604 TGAGTCACTGACTTCAGGAAGGG No data
908445442_908445446 -10 Left 908445442 1:64195569-64195591 CCCTCTCATGCTTTGAGTCACTG No data
Right 908445446 1:64195582-64195604 TGAGTCACTGACTTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908445446 Original CRISPR TGAGTCACTGACTTCAGGAA GGG Intergenic
No off target data available for this crispr