ID: 908445448

View in Genome Browser
Species Human (GRCh38)
Location 1:64195600-64195622
Sequence AAGGGCCTAGTCCCATTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908445440_908445448 22 Left 908445440 1:64195555-64195577 CCCTTACACGGAATCCCTCTCAT No data
Right 908445448 1:64195600-64195622 AAGGGCCTAGTCCCATTTAAGGG No data
908445443_908445448 7 Left 908445443 1:64195570-64195592 CCTCTCATGCTTTGAGTCACTGA No data
Right 908445448 1:64195600-64195622 AAGGGCCTAGTCCCATTTAAGGG No data
908445441_908445448 21 Left 908445441 1:64195556-64195578 CCTTACACGGAATCCCTCTCATG No data
Right 908445448 1:64195600-64195622 AAGGGCCTAGTCCCATTTAAGGG No data
908445442_908445448 8 Left 908445442 1:64195569-64195591 CCCTCTCATGCTTTGAGTCACTG No data
Right 908445448 1:64195600-64195622 AAGGGCCTAGTCCCATTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908445448 Original CRISPR AAGGGCCTAGTCCCATTTAA GGG Intergenic
No off target data available for this crispr