ID: 908447671

View in Genome Browser
Species Human (GRCh38)
Location 1:64216337-64216359
Sequence GAATACCAGTAGGCTCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908447668_908447671 6 Left 908447668 1:64216308-64216330 CCTTCTCTGGCTTGGTGGGCTTT 0: 1
1: 0
2: 1
3: 28
4: 282
Right 908447671 1:64216337-64216359 GAATACCAGTAGGCTCCACTTGG 0: 1
1: 0
2: 1
3: 5
4: 62
908447667_908447671 7 Left 908447667 1:64216307-64216329 CCCTTCTCTGGCTTGGTGGGCTT No data
Right 908447671 1:64216337-64216359 GAATACCAGTAGGCTCCACTTGG 0: 1
1: 0
2: 1
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908447671 Original CRISPR GAATACCAGTAGGCTCCACT TGG Intronic
900942888 1:5812367-5812389 CAATTCCACTAGCCTCCACTGGG + Intergenic
906798736 1:48718213-48718235 AAATCCCAGTAGGGTCTACTTGG + Intronic
906834078 1:49064133-49064155 AAACACCAGTAGGCTACAGTTGG + Intronic
908184181 1:61636037-61636059 CAGTACCCGTAGGCTCCTCTTGG + Intergenic
908447671 1:64216337-64216359 GAATACCAGTAGGCTCCACTTGG + Intronic
918113442 1:181477876-181477898 TAATACCATTCTGCTCCACTGGG - Intronic
1064787175 10:18910992-18911014 CAATACTAATAGGCTGCACTTGG - Intergenic
1065427082 10:25616842-25616864 GCATACTGGAAGGCTCCACTGGG - Intergenic
1066450377 10:35522891-35522913 GAAAACCTGAAGGGTCCACTGGG - Intronic
1072450549 10:95536353-95536375 GAATACCAGTGAGTTCCACCAGG + Intronic
1073845423 10:107548423-107548445 GAGTCTCAGTAGGCTGCACTTGG - Intergenic
1079391554 11:20026114-20026136 TAATACCAGGAGGCTCCAAATGG - Intronic
1080354023 11:31420327-31420349 GAATACCAGAAGGCTCTGGTGGG - Intronic
1086952769 11:92908081-92908103 GTATACCTGTAGGGTCAACTGGG - Intergenic
1092550480 12:9493947-9493969 GAATAACAGTAGATTCCTCTGGG - Intergenic
1094521336 12:31192421-31192443 GAATAACAGTAGATTCCTCTGGG + Intergenic
1094636046 12:32227740-32227762 GAGTACCCGTAGCCTCCATTGGG + Intronic
1096898116 12:54845600-54845622 GGTTACCAGTAGGGTACACTTGG + Intronic
1105840496 13:24249717-24249739 GAAGACCAGAATGCTCCAGTGGG + Exonic
1107716161 13:43201716-43201738 GAACCCCTGTAGACTCCACTGGG + Intergenic
1107871778 13:44753272-44753294 GAATTGAAGTAGGCTCTACTGGG + Intergenic
1109713377 13:66187827-66187849 GAATTCCAGTGGGCTCCAGTGGG - Intergenic
1116037658 14:39647238-39647260 GAATAGCAGTTGTCTGCACTGGG + Intergenic
1116374418 14:44180482-44180504 GAATACCAGTAGTTTCCATGTGG - Intergenic
1125838123 15:42772060-42772082 GAATACCAGGAGACACCTCTGGG - Intronic
1128725233 15:69983102-69983124 AAATACCACTCAGCTCCACTTGG + Intergenic
1135223674 16:20637119-20637141 GAATACCTAGAGGCTGCACTGGG - Intronic
1138478841 16:57288232-57288254 GAATGCCAGCAGGCCCCACCAGG - Intergenic
1138492727 16:57385640-57385662 GGATACCAGTAGGCTGGACTTGG - Intergenic
1144851007 17:18244004-18244026 GCTAACCTGTAGGCTCCACTGGG + Exonic
1150737334 17:67751791-67751813 GACTACAGGTAGGCACCACTGGG - Intergenic
1151378229 17:73706478-73706500 AAATACCATTTGGATCCACTGGG - Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1153948295 18:10036037-10036059 GAAGACCAGTGGGTTCGACTGGG - Intergenic
1156236662 18:35212025-35212047 CAATACCAGTAGACTACAATAGG + Intergenic
1158295462 18:55992295-55992317 GAAGGCCAGTGGGCTTCACTGGG - Intergenic
1161489266 19:4552913-4552935 GGATATCAGTAGGCCCCCCTCGG - Intronic
1168135990 19:54352227-54352249 GAACACCAGGAGGCTGCAGTGGG - Exonic
926137355 2:10346260-10346282 GAATACCAGGAGGCTCCCCATGG - Intronic
926805169 2:16702981-16703003 GAATCTCAATTGGCTCCACTAGG + Intergenic
927268749 2:21183008-21183030 GCATTCCAGAAGGTTCCACTTGG + Intergenic
929945336 2:46367308-46367330 GAATGCCAGTAGGCTCATTTTGG + Intronic
930269757 2:49242153-49242175 AAATACCAGTACATTCCACTTGG + Intergenic
931875644 2:66508821-66508843 GGATAGCAGTAGGCTCCAGTGGG - Intronic
932895823 2:75638439-75638461 GAATAACAGGAGACTCCATTTGG + Intergenic
935462385 2:103353601-103353623 AATTACCACTAGACTCCACTGGG - Intergenic
944002783 2:194861623-194861645 GAATAACAGTAAGTTCCATTTGG - Intergenic
946309835 2:218877377-218877399 GATTACCAGAAGGCACCATTGGG + Intergenic
947240692 2:227991126-227991148 GATCACCAGCAGGCTCCTCTGGG + Exonic
1170404055 20:16017995-16018017 GAATACCACTAGATGCCACTAGG - Intronic
1175077469 20:56388481-56388503 GTATGCCAGTAGGCTGCACAGGG - Intronic
1177487036 21:21772409-21772431 GAATACTAGTAGTCTACTCTGGG - Intergenic
963054177 3:141171106-141171128 AGATACCACCAGGCTCCACTCGG + Intergenic
967211199 3:187171059-187171081 GATTACCAGTGTGCTCCACCAGG + Intronic
969853736 4:9982629-9982651 GAATCTCAGTTGCCTCCACTAGG + Intronic
970473007 4:16395210-16395232 TAATCCCTGTAGGCTCCACTTGG + Intergenic
974352005 4:60760583-60760605 ATATACCATTAGGCTCCTCTTGG - Intergenic
982193913 4:152889440-152889462 GAATACCAGAAGGCTGCACTGGG - Intronic
1000382951 5:160645326-160645348 GACTACCTGGAGGCTCCCCTTGG - Intronic
1007664610 6:43506892-43506914 AACTACCAGTAAGCACCACTAGG - Intergenic
1008447124 6:51605639-51605661 GAATACACTTAGGGTCCACTTGG - Intergenic
1017520227 6:155195546-155195568 AAATACAAGTAAGCTCCACGTGG - Intronic
1020029933 7:4925548-4925570 GAATTCCAGGAAGCTCCGCTGGG + Intronic
1023330880 7:39115482-39115504 GGAGACCAGCAGGCTCTACTGGG - Intronic
1055377675 9:75667615-75667637 GAATTCACGTAGGATCCACTGGG - Intergenic
1057599214 9:96442718-96442740 GTATACCAGTTGCCCCCACTAGG + Intergenic
1202798637 9_KI270719v1_random:151303-151325 TAGTACCAGTAGGCTCACCTGGG - Intergenic
1191870469 X:65740958-65740980 TGATGCCAGTAGGCTCAACTAGG + Exonic
1198021779 X:132665994-132666016 GAATCTCAGTAGGCTCCAAATGG + Intronic