ID: 908456388

View in Genome Browser
Species Human (GRCh38)
Location 1:64308690-64308712
Sequence AATGTAGACACTATAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908456388_908456395 23 Left 908456388 1:64308690-64308712 CCATTTTCTATAGTGTCTACATT No data
Right 908456395 1:64308736-64308758 TGGCTTTGCTCTGAAGCTCTGGG No data
908456388_908456390 -5 Left 908456388 1:64308690-64308712 CCATTTTCTATAGTGTCTACATT No data
Right 908456390 1:64308708-64308730 ACATTCCCTTGACAAGTGGTTGG No data
908456388_908456393 3 Left 908456388 1:64308690-64308712 CCATTTTCTATAGTGTCTACATT No data
Right 908456393 1:64308716-64308738 TTGACAAGTGGTTGGAAGCATGG No data
908456388_908456389 -9 Left 908456388 1:64308690-64308712 CCATTTTCTATAGTGTCTACATT No data
Right 908456389 1:64308704-64308726 GTCTACATTCCCTTGACAAGTGG No data
908456388_908456394 22 Left 908456388 1:64308690-64308712 CCATTTTCTATAGTGTCTACATT No data
Right 908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908456388 Original CRISPR AATGTAGACACTATAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr