ID: 908456391 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:64308713-64308735 |
Sequence | TGCTTCCAACCACTTGTCAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908456391_908456394 | -1 | Left | 908456391 | 1:64308713-64308735 | CCCTTGACAAGTGGTTGGAAGCA | No data | ||
Right | 908456394 | 1:64308735-64308757 | ATGGCTTTGCTCTGAAGCTCTGG | No data | ||||
908456391_908456395 | 0 | Left | 908456391 | 1:64308713-64308735 | CCCTTGACAAGTGGTTGGAAGCA | No data | ||
Right | 908456395 | 1:64308736-64308758 | TGGCTTTGCTCTGAAGCTCTGGG | No data | ||||
908456391_908456396 | 26 | Left | 908456391 | 1:64308713-64308735 | CCCTTGACAAGTGGTTGGAAGCA | No data | ||
Right | 908456396 | 1:64308762-64308784 | TAGATAATTAGAGACAAACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908456391 | Original CRISPR | TGCTTCCAACCACTTGTCAA GGG (reversed) | Intergenic | ||