ID: 908456391

View in Genome Browser
Species Human (GRCh38)
Location 1:64308713-64308735
Sequence TGCTTCCAACCACTTGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908456391_908456396 26 Left 908456391 1:64308713-64308735 CCCTTGACAAGTGGTTGGAAGCA No data
Right 908456396 1:64308762-64308784 TAGATAATTAGAGACAAACCAGG No data
908456391_908456395 0 Left 908456391 1:64308713-64308735 CCCTTGACAAGTGGTTGGAAGCA No data
Right 908456395 1:64308736-64308758 TGGCTTTGCTCTGAAGCTCTGGG No data
908456391_908456394 -1 Left 908456391 1:64308713-64308735 CCCTTGACAAGTGGTTGGAAGCA No data
Right 908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908456391 Original CRISPR TGCTTCCAACCACTTGTCAA GGG (reversed) Intergenic
No off target data available for this crispr