ID: 908456394

View in Genome Browser
Species Human (GRCh38)
Location 1:64308735-64308757
Sequence ATGGCTTTGCTCTGAAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908456392_908456394 -2 Left 908456392 1:64308714-64308736 CCTTGACAAGTGGTTGGAAGCAT No data
Right 908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG No data
908456388_908456394 22 Left 908456388 1:64308690-64308712 CCATTTTCTATAGTGTCTACATT No data
Right 908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG No data
908456391_908456394 -1 Left 908456391 1:64308713-64308735 CCCTTGACAAGTGGTTGGAAGCA No data
Right 908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908456394 Original CRISPR ATGGCTTTGCTCTGAAGCTC TGG Intergenic
No off target data available for this crispr