ID: 908456396

View in Genome Browser
Species Human (GRCh38)
Location 1:64308762-64308784
Sequence TAGATAATTAGAGACAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908456392_908456396 25 Left 908456392 1:64308714-64308736 CCTTGACAAGTGGTTGGAAGCAT No data
Right 908456396 1:64308762-64308784 TAGATAATTAGAGACAAACCAGG No data
908456391_908456396 26 Left 908456391 1:64308713-64308735 CCCTTGACAAGTGGTTGGAAGCA No data
Right 908456396 1:64308762-64308784 TAGATAATTAGAGACAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908456396 Original CRISPR TAGATAATTAGAGACAAACC AGG Intergenic
No off target data available for this crispr