ID: 908457963

View in Genome Browser
Species Human (GRCh38)
Location 1:64322417-64322439
Sequence CTGAATATGAATAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908457957_908457963 22 Left 908457957 1:64322372-64322394 CCTCTTCCTTTTATGAAAGCTAA No data
Right 908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG No data
908457959_908457963 -8 Left 908457959 1:64322402-64322424 CCTCTTCTCTTCCTACTGAATAT No data
Right 908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG No data
908457958_908457963 16 Left 908457958 1:64322378-64322400 CCTTTTATGAAAGCTAACAGAGA No data
Right 908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908457963 Original CRISPR CTGAATATGAATAAGGCAGA GGG Intergenic
No off target data available for this crispr