ID: 908459713

View in Genome Browser
Species Human (GRCh38)
Location 1:64337666-64337688
Sequence CTGGAAGGTGGAAACAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908459713_908459723 15 Left 908459713 1:64337666-64337688 CCCCATCTGTTTCCACCTTCCAG No data
Right 908459723 1:64337704-64337726 AAGTCAAGTGGGTAACAGCTGGG No data
908459713_908459724 16 Left 908459713 1:64337666-64337688 CCCCATCTGTTTCCACCTTCCAG No data
Right 908459724 1:64337705-64337727 AGTCAAGTGGGTAACAGCTGGGG No data
908459713_908459722 14 Left 908459713 1:64337666-64337688 CCCCATCTGTTTCCACCTTCCAG No data
Right 908459722 1:64337703-64337725 GAAGTCAAGTGGGTAACAGCTGG No data
908459713_908459721 4 Left 908459713 1:64337666-64337688 CCCCATCTGTTTCCACCTTCCAG No data
Right 908459721 1:64337693-64337715 CTTTGCAGCGGAAGTCAAGTGGG No data
908459713_908459720 3 Left 908459713 1:64337666-64337688 CCCCATCTGTTTCCACCTTCCAG No data
Right 908459720 1:64337692-64337714 GCTTTGCAGCGGAAGTCAAGTGG No data
908459713_908459718 -8 Left 908459713 1:64337666-64337688 CCCCATCTGTTTCCACCTTCCAG No data
Right 908459718 1:64337681-64337703 CCTTCCAGTATGCTTTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908459713 Original CRISPR CTGGAAGGTGGAAACAGATG GGG (reversed) Intergenic
No off target data available for this crispr