ID: 908471529

View in Genome Browser
Species Human (GRCh38)
Location 1:64448741-64448763
Sequence CTGAAATAGCTGGAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908471524_908471529 -7 Left 908471524 1:64448725-64448747 CCAGAAACCGGAATCACTGAAAT No data
Right 908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908471529 Original CRISPR CTGAAATAGCTGGAGGAGAA GGG Intergenic
No off target data available for this crispr