ID: 908474184

View in Genome Browser
Species Human (GRCh38)
Location 1:64471549-64471571
Sequence CCTCCCGGGAGCATGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 373}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908474173_908474184 -9 Left 908474173 1:64471535-64471557 CCGCGCTCCTTTCCCCTCCCGGG 0: 1
1: 1
2: 2
3: 37
4: 417
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373
908474165_908474184 21 Left 908474165 1:64471505-64471527 CCCGGCGGAGAGCGGCCCTCCGA No data
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373
908474171_908474184 2 Left 908474171 1:64471524-64471546 CCGAGTGGGCTCCGCGCTCCTTT 0: 1
1: 0
2: 2
3: 9
4: 73
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373
908474164_908474184 28 Left 908474164 1:64471498-64471520 CCTAGGTCCCGGCGGAGAGCGGC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373
908474166_908474184 20 Left 908474166 1:64471506-64471528 CCGGCGGAGAGCGGCCCTCCGAG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373
908474169_908474184 6 Left 908474169 1:64471520-64471542 CCCTCCGAGTGGGCTCCGCGCTC No data
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373
908474170_908474184 5 Left 908474170 1:64471521-64471543 CCTCCGAGTGGGCTCCGCGCTCC No data
Right 908474184 1:64471549-64471571 CCTCCCGGGAGCATGGGGGGAGG 0: 1
1: 0
2: 0
3: 51
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908474184 Original CRISPR CCTCCCGGGAGCATGGGGGG AGG Intronic