ID: 908476224

View in Genome Browser
Species Human (GRCh38)
Location 1:64491434-64491456
Sequence AGCAAGGCATGCCTTATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908476216_908476224 16 Left 908476216 1:64491395-64491417 CCTCAGGAAACTTACAATCATGG 0: 5548
1: 8228
2: 6830
3: 4292
4: 3006
Right 908476224 1:64491434-64491456 AGCAAGGCATGCCTTATACATGG 0: 1
1: 0
2: 0
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908476224 Original CRISPR AGCAAGGCATGCCTTATACA TGG Intronic
901442384 1:9286285-9286307 AGCAATGGATGACTGATACAAGG + Intergenic
902531737 1:17094912-17094934 AGCAAGGCTTGCCTGAGACCAGG - Intronic
902954086 1:19912653-19912675 AGCAAGTCTTGCCTTATCTATGG + Exonic
903051602 1:20605255-20605277 AGCAAGGCAACTCTCATACAAGG + Intronic
906292532 1:44628703-44628725 AGAAAGGAATGCCTCATCCAGGG - Intronic
908476224 1:64491434-64491456 AGCAAGGCATGCCTTATACATGG + Intronic
909938835 1:81587478-81587500 ACCAAAGCATGTCTTATTCAGGG + Intronic
912485623 1:110025322-110025344 AGCAAGGAAGGCCTTAAAAAAGG + Intergenic
914936186 1:151982423-151982445 TGGTAGGCATGACTTATACACGG - Intergenic
919620225 1:199856712-199856734 AGCAAGGCATGCTTTGTATCAGG - Intergenic
920363707 1:205436900-205436922 AGGAAGGCACGCATTATAAAGGG - Intronic
1065825571 10:29567633-29567655 AGGAAGGCATTCCTTATTCAAGG - Intronic
1065951746 10:30658645-30658667 AGGAAGGCATTCCTCATTCAAGG + Intergenic
1067218780 10:44326373-44326395 AGCAAGGAATCCCATAAACAAGG + Intergenic
1068084143 10:52353631-52353653 AATAAGACATGCCTTATAAATGG + Intergenic
1068418430 10:56757712-56757734 AGAAAGACATGCTTTATAAAAGG - Intergenic
1069535081 10:69247356-69247378 AGCAAGGCCTTCTTTATACCTGG - Exonic
1073903663 10:108251666-108251688 AGCAGGGCATGAATTCTACAGGG + Intergenic
1077225863 11:1438903-1438925 AGCCAGGCATGCCTGGGACAGGG - Intronic
1079351560 11:19696006-19696028 AGCAAGCCAAGCCTCATTCAAGG - Intronic
1080751016 11:35150350-35150372 AGCAAGGCAGGCCTGAGAGATGG + Intronic
1082944527 11:58743421-58743443 AGAAATTCATGCCTTATGCAGGG + Intergenic
1083080571 11:60088284-60088306 AACCAAGCATGCCTTAAACAAGG + Intronic
1083916644 11:65749504-65749526 AGCTAGGCATGCCTGCAACAAGG + Intergenic
1085249190 11:75130961-75130983 AGAATGGCATGGCATATACAGGG + Intronic
1085799022 11:79570613-79570635 AGAAAGGGATGTATTATACAAGG - Intergenic
1089910577 11:122095906-122095928 AGCAAGGAATGTCTTTAACAAGG + Intergenic
1091485096 12:878827-878849 AGAAAAGCATACCTTCTACAGGG - Intronic
1094377234 12:29802881-29802903 AGCAATGCATGCCATAGGCAAGG + Intergenic
1097640187 12:62171622-62171644 AGCAAGGGGTGCCTTCTACAAGG + Intronic
1102438022 12:112940317-112940339 AGCAAGGCTTGCCTCAAACTGGG - Intronic
1104455665 12:128909879-128909901 TGCAAGGCAGGCCGTACACAAGG + Intronic
1106575637 13:30971927-30971949 AGGAAGAAATGCCTTTTACATGG - Intronic
1107125074 13:36837876-36837898 AGGAATTCATGCCTTATGCAGGG - Intergenic
1108167612 13:47709578-47709600 AGGAATTCATGCCTTATGCAAGG + Intergenic
1111508966 13:89235294-89235316 TGAAAGGCATGTCTTTTACATGG - Intergenic
1113115573 13:106871440-106871462 TGCAAGGCATACCTTCTAGAAGG + Intergenic
1118420082 14:65592934-65592956 ACCAAGGCATGTTCTATACATGG + Intronic
1118999077 14:70865166-70865188 AGGAATTCATGCCTTATTCAGGG - Intergenic
1118999932 14:70872606-70872628 AGCAATTCATGCCTTATTCAGGG - Intergenic
1125061851 15:35435507-35435529 AGGAATTCATGCCTTATGCAGGG + Intronic
1125386733 15:39144938-39144960 AGCAAGAAATGCCTTTTAAATGG - Intergenic
1126919389 15:53504160-53504182 AGCAAGGGATGCTTTACAAAAGG + Intergenic
1128735493 15:70051519-70051541 AGCAAGACCTGCCCTAGACATGG + Intronic
1129625704 15:77196568-77196590 AGCAAGGCATACATAAAACATGG + Intronic
1130158174 15:81371384-81371406 AGAAATGCAAGCCTAATACATGG + Intronic
1131768451 15:95706753-95706775 AGCAAAGCATGTCTTTTCCAAGG - Intergenic
1133755279 16:8757941-8757963 ATCAAGGCATGCCACATACCTGG - Intronic
1136619729 16:31420336-31420358 AGCAAGGCATCCCATACACTGGG + Intronic
1137416098 16:48282038-48282060 AACAAGGTATGCCTTATTTAAGG - Intronic
1138829666 16:60360183-60360205 AGCCAGGCCTGCCTTCTCCATGG + Intergenic
1141182408 16:81763267-81763289 AGCAATGGATGACTGATACAGGG - Intronic
1141734220 16:85841373-85841395 AGGAAGGCATCCCTTCTACCTGG + Intergenic
1144262247 17:13533212-13533234 AGCAGTGCATGCCATTTACAAGG - Intronic
1146521695 17:33530457-33530479 AGCAAGGCCTTCCTAATTCATGG + Intronic
1148128554 17:45248895-45248917 TGCAAGGCAGGCCTTCTGCAGGG - Intergenic
1150709172 17:67515287-67515309 AGGAAGGCATGCCCAATAGAAGG + Intronic
1153662671 18:7339259-7339281 AGCAAGGCATCCATTCTTCAGGG - Intergenic
1154421744 18:14236531-14236553 AGAAATTCATGCCTTATGCAGGG - Intergenic
1156850191 18:41717195-41717217 AGCAAGCAATGCCTTAAAAATGG - Intergenic
1162723233 19:12674715-12674737 AGCAAGGCATGCTCCAAACATGG + Intronic
1162880545 19:13655697-13655719 AGCAATGCATGCCTGCTGCAGGG - Intergenic
925152156 2:1622453-1622475 AGCAAGGCACGCCCTAACCAGGG + Intergenic
926404818 2:12540405-12540427 AGAGAGGCATGGCTTATTCATGG - Intergenic
927555801 2:24030932-24030954 ATCAAGCCATGCCATCTACATGG + Exonic
933333624 2:80926340-80926362 AGGAATTCATGCCTTATGCAGGG - Intergenic
933375522 2:81475636-81475658 AACAAATCATGCCTTAAACAGGG - Intergenic
935426644 2:102925934-102925956 AGCTAGGTATGTCTTATTCAAGG + Intergenic
938122743 2:128645201-128645223 AGCAGGGCATGCCTAAGGCATGG + Intergenic
938839016 2:135139931-135139953 AGCAAAGCATGCCATTTAAAAGG - Intronic
941770263 2:169337378-169337400 AGCAAAGATGGCCTTATACATGG - Intronic
942591574 2:177552479-177552501 ATAAAGGCAGGCCTTGTACAGGG + Exonic
942598697 2:177618417-177618439 ATAAAGGCAGGCCTTGTACAGGG + Exonic
942619009 2:177827399-177827421 AGTAGGGCAGGCCTTATGCATGG - Intronic
942626917 2:177911495-177911517 AAAAAGGCATGCCTTAGCCAAGG - Intronic
947769734 2:232661463-232661485 AGGAAGGGAAGGCTTATACACGG - Intronic
1173531180 20:43770835-43770857 AGAAAGGGATGCATGATACAGGG - Intergenic
1174089461 20:48035488-48035510 ATAAAGGCATACCTGATACAGGG - Intergenic
1176851739 21:13923429-13923451 AGGAATTCATGCCTTATGCAGGG + Intergenic
1179052862 21:37903670-37903692 AATAAGGCAAGACTTATACATGG - Intronic
1179063038 21:37997429-37997451 AGCAAGGCACGTCTTATACGGGG + Intronic
1181548829 22:23623521-23623543 AGAAAGGCATCCCATATTCATGG + Intronic
1182922848 22:34096077-34096099 AGCAAGGCAGGCTTTAGTCAAGG - Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183706438 22:39477482-39477504 AGCAAGGCCTGGCATATTCAGGG + Intronic
950360185 3:12444528-12444550 AGCAAGGCATGCCTCTTGGACGG - Intergenic
953611138 3:44448424-44448446 AGAAAGGAATCCCTTAAACATGG - Exonic
955260916 3:57389703-57389725 GGCAAGGAATGGCTCATACATGG + Intronic
962919618 3:139938653-139938675 AGAAAGACATGTCTTATCCAAGG + Intronic
963538800 3:146561449-146561471 AGCAAGGCATGTCCTTCACAAGG + Intergenic
964496890 3:157301126-157301148 AGCATTGCAAGCCTTATCCACGG + Intronic
965111082 3:164423861-164423883 TGCAATGCATGCATGATACATGG - Intergenic
969764262 4:9215916-9215938 GGGAAGGCATGCCTTTTTCATGG - Exonic
969764868 4:9220663-9220685 GGGAAGGCATGCCTTTTTCATGG - Exonic
969765475 4:9225407-9225429 GGGAAGGCATGCCTTTTTCATGG - Exonic
969766088 4:9230152-9230174 GGGAAGGCATGCCTTTTTCATGG - Intergenic
969766701 4:9234896-9234918 GGGAAGGCATGCCTTTTTCATGG - Exonic
969767312 4:9239641-9239663 GGGAAGGCATGCCTTTTTCATGG - Intronic
969767917 4:9244390-9244412 GGGAAGGCATGCCTTTTTCATGG - Exonic
969768519 4:9249141-9249163 GGGAAGGCATGCCTTTTTCATGG - Exonic
969769126 4:9253889-9253911 GGGAAGGCATGCCTTTTTCATGG - Exonic
969769740 4:9258635-9258657 GGGAAGGCATGCCTTTTTCATGG - Exonic
969770345 4:9263383-9263405 GGGAAGGCATGCCTTTTTCATGG - Exonic
969770962 4:9268130-9268152 GGGAAGGCATGCCTTTTTCATGG - Exonic
969771573 4:9272875-9272897 GGGAAGGCATGCCTTTTCCATGG - Exonic
969771940 4:9325676-9325698 GGGAAGGCATGCCTTTTTCATGG - Exonic
969772556 4:9330422-9330444 GGGAAGGCATGCCTTTTTCATGG - Exonic
969773173 4:9335169-9335191 GGGAAGGCATGCCTTTTTCATGG - Exonic
969773788 4:9339914-9339936 GGGAAGGCATGCCTTTTTCATGG - Exonic
969774403 4:9344659-9344681 GGGAAGGCATGCCTTTTTCATGG - Exonic
969775018 4:9349404-9349426 GGGAAGGCATGCCTTTTTCATGG - Exonic
969775633 4:9354149-9354171 GGGAAGGCATGCCTTTTTCATGG - Exonic
969776248 4:9358894-9358916 GGGAAGGCATGCCTTTTTCATGG - Intronic
969776862 4:9363640-9363662 GGGAAGGCATGCCTTTTTCATGG - Exonic
969777477 4:9368385-9368407 GGGAAGGCATGCCTTTTTCATGG - Intergenic
972902820 4:43705794-43705816 AGCAAGGCATGTCTTACATGGGG - Intergenic
974979916 4:68942672-68942694 AGCATGGTATCCCTTATACGTGG + Intronic
976261374 4:83148081-83148103 AGCAATACATGCTTTATAAAAGG - Intergenic
976349339 4:84043077-84043099 AGAATGGGATGCCTTATAAAAGG - Intergenic
976368129 4:84253953-84253975 AGAAAGATATGCCTAATACATGG - Intergenic
979014650 4:115418486-115418508 AGGAATTCATGCCTTATGCATGG + Intergenic
980517342 4:133879697-133879719 AGCAAGGCATGCTGAACACAGGG + Intergenic
981654903 4:147102032-147102054 AGCAAGGCAGGCCCTGGACAAGG + Intergenic
984327920 4:178276146-178276168 AGGAATTCATGCCTTATGCAAGG + Intergenic
986427265 5:7646530-7646552 AGAAAGGCATAGTTTATACAAGG + Intronic
988225941 5:28411488-28411510 AGGAAGGCATCCCTTAGGCATGG + Intergenic
988355008 5:30162394-30162416 AGCAAGTCATGTCTTATAAGGGG + Intergenic
990057949 5:51609038-51609060 GGCAAGGCTTGACTTATAAAAGG + Intergenic
991032817 5:62100408-62100430 GGCAAGGCAAGACTTGTACAGGG + Intergenic
997346935 5:133198929-133198951 AGCAGCGCATACCTTATACTAGG + Exonic
998523679 5:142823279-142823301 AGCAAGCCATGGCTTCTGCATGG + Intronic
998528853 5:142866942-142866964 AGCAAGTCAAGCCTGAGACATGG - Intronic
1000984645 5:167853655-167853677 AGAAAGGCATGCCATATTAAGGG - Intronic
1005242970 6:23853696-23853718 AGCCAGGCCTGCCTTCTCCATGG - Intergenic
1005676123 6:28157150-28157172 AGCAAATCATGTCTTATACATGG + Exonic
1005907057 6:30271625-30271647 AGAAAGGGAACCCTTATACATGG + Intergenic
1008342255 6:50381630-50381652 AGCAAAGAATGCCTTTTGCATGG + Intergenic
1010433804 6:75808100-75808122 AGCAAGGAATACTTTATTCAAGG + Intronic
1010932645 6:81820814-81820836 AGCAAAGGATGCCTCATAAAAGG - Intergenic
1015410932 6:132893081-132893103 AGCAAGCCATTCCTTTTAAAAGG - Intergenic
1016585963 6:145686121-145686143 ACCAAGCCATGCATTATTCAAGG - Exonic
1017078865 6:150647177-150647199 AGTTAGGCATGGCTTAAACAAGG - Intronic
1017560007 6:155616339-155616361 AGGAATGCATACCTTATGCAGGG - Intergenic
1020429945 7:8108531-8108553 AGCCTGGCATGTCTTATGCAAGG + Intergenic
1021191860 7:17629982-17630004 AGCACACCTTGCCTTATACATGG + Intergenic
1023514890 7:40992140-40992162 AACAAGGGATGGCTTATTCATGG + Intergenic
1024963361 7:55001701-55001723 ACCAAGGCTTGCCTTAGAAACGG - Intergenic
1031515771 7:122696410-122696432 AGCAAGGCATGGCTCACACCTGG + Intronic
1035981954 8:4382144-4382166 AGCAAAGCATGCATTCTTCATGG + Intronic
1036273800 8:7332898-7332920 GGGAAGGCATGCCTTTTTCATGG - Intergenic
1036274381 8:7337626-7337648 GGGAAGGCATGCCTTTTTCATGG - Intergenic
1036346968 8:7972720-7972742 GGGAAGGCATGCCTTTTTCATGG + Intergenic
1036347546 8:7977452-7977474 GGGAAGGCATGCCTTTTTCATGG + Intergenic
1036842296 8:12133476-12133498 GGGAAGGCATGCCTTTTTCATGG + Intergenic
1036842853 8:12138227-12138249 GGGAAGGCATGCCTTTTTCATGG + Exonic
1036864133 8:12379731-12379753 GGGAAGGCATGCCTTTTTCATGG + Intergenic
1037841541 8:22248704-22248726 TGCAAGGGATGCCTGATGCACGG - Intronic
1038380909 8:27092791-27092813 TGGAAGGCATGGCTTATACGTGG + Intergenic
1040994155 8:53384708-53384730 AGGAATTCATGCCTTATGCAGGG - Intergenic
1041351598 8:56952620-56952642 AGGAATTCATGCCTTATGCAGGG + Intergenic
1043680978 8:83023945-83023967 AGGAATTCATGCCTTATGCAGGG - Intergenic
1049141120 8:140955369-140955391 AGCAAGACATATCTTACACACGG - Intronic
1053338454 9:37300363-37300385 AGCAAAGCATGCTTCATACATGG + Intronic
1055829452 9:80360717-80360739 AGCCAGGCCTGCCTTCTCCATGG + Intergenic
1057071369 9:92103691-92103713 AGCAAGGCCCGCCTTCTCCATGG - Intronic
1058583535 9:106483624-106483646 GGCAGGTCATGCCTTAGACAGGG - Intergenic
1058674503 9:107388990-107389012 GGCAAGGCCTGCCTTATCCCCGG + Intergenic
1058764412 9:108167452-108167474 AGCAATTCATGCCTTTCACATGG - Intergenic
1059011555 9:110467143-110467165 AGCAAGACATGCCTAAAATAAGG - Intronic
1060462592 9:123871680-123871702 TGAAAGGCATGCCTAAGACATGG - Intronic
1062003568 9:134228603-134228625 AGCAAGGCCCGCCTTCTATAAGG + Intergenic
1185833733 X:3325017-3325039 AGAATGGCATGCCTTGCACATGG + Intronic
1186207307 X:7214141-7214163 TGCAAAGCATGCCTGATACATGG + Intergenic
1188977346 X:36691184-36691206 AGCAAGGCATGCCTAATTCTAGG - Intergenic
1196586223 X:117431773-117431795 TTCAATGCATGCCTTAAACATGG + Intergenic
1199113716 X:143964638-143964660 AGCAAGTCATTATTTATACAAGG - Intergenic
1201241993 Y:11968014-11968036 AGAATGGCACGCCTTGTACATGG - Intergenic
1201900965 Y:19045930-19045952 AGCAAGGCTTCCAGTATACAAGG + Intergenic