ID: 908478512

View in Genome Browser
Species Human (GRCh38)
Location 1:64512970-64512992
Sequence ATGGAAAAACAGAACAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1059
Summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 960}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908478512 Original CRISPR ATGGAAAAACAGAACAAGGA TGG (reversed) Intronic
901160262 1:7172034-7172056 AAGGAAAAATGGAACAGGGATGG - Intronic
901400240 1:9010751-9010773 ATGAATGACCAGAACAAGGAAGG - Intronic
901406545 1:9051188-9051210 AAAGAAAAAGAGAAGAAGGAAGG + Intronic
901988629 1:13094491-13094513 ATGAAATAAAAGAACAAGAATGG + Intergenic
901993184 1:13132276-13132298 ATGAAATAAAAGAACAAGAATGG - Intergenic
902159142 1:14515546-14515568 ATGGTAGAACAGGAGAAGGATGG - Intergenic
902219664 1:14957050-14957072 ACGAAGAAACAGAACACGGAAGG - Intronic
902265669 1:15261750-15261772 ATGCAGAAACAGAACAAGCTGGG - Intronic
902827572 1:18987524-18987546 ATGGAAAATTAGGACAAGAAAGG - Intergenic
903430120 1:23290740-23290762 ATGAAAAAAAAGAACCAGAAAGG + Intergenic
903803872 1:25990289-25990311 AGGGGAAAACAGATCAAGGCAGG + Intronic
904198484 1:28803721-28803743 ATGGAAAGACAGAATAAGCCTGG - Intergenic
905057327 1:35107149-35107171 TTTTAAAAACAGAACAAGGCCGG - Intronic
905895664 1:41544498-41544520 ATGGAATAACTGGACAGGGAGGG + Intronic
906364278 1:45192492-45192514 ATAGAAAGACAGAGAAAGGAAGG + Intronic
906673493 1:47676962-47676984 AGGGAAAGACAGAGCAAGGAGGG - Intergenic
906858551 1:49333795-49333817 ATGGCCAAACTGAACAAGGAGGG - Intronic
906882682 1:49609507-49609529 ATGGTACAACAGAAAAAGAAGGG + Intronic
907100302 1:51826971-51826993 ATGAAAAAACAAAACAACTAAGG - Intronic
907229948 1:52987600-52987622 ATGGAAAAACAGGAGAAAAAAGG - Intronic
907535685 1:55153877-55153899 TTGGAAAAAAACAAGAAGGATGG - Exonic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908492390 1:64659120-64659142 TGAGAAAAACAGGACAAGGAAGG + Intronic
908677843 1:66625848-66625870 ATTGAAAAAACGTACAAGGAAGG + Exonic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909302597 1:74032257-74032279 TTGGGAAAACAGAACAAAGTTGG + Intronic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
909385886 1:75056319-75056341 ATGGAAAAATAAAACAAGCAAGG + Intergenic
909626362 1:77720210-77720232 GTGGAAAAAAAGATAAAGGATGG + Intronic
909629647 1:77758697-77758719 TAGGAAAAACGGAACTAGGACGG + Intronic
909695398 1:78463225-78463247 ATGGAAAACAAGAAAAAGCAGGG - Intronic
910017422 1:82544379-82544401 ATGAAGAAACAGAACAAAGCTGG + Intergenic
910043359 1:82881859-82881881 AGGGGAAAACAGATCAAGAATGG - Intergenic
910513446 1:88032905-88032927 ATTGAAATAAAGAACAAGGTTGG + Intergenic
910667470 1:89740640-89740662 ATAGAAAAATAAAACAAAGAAGG - Intronic
910835828 1:91509071-91509093 AGGGAAGAAGAAAACAAGGAGGG - Intronic
911031741 1:93496243-93496265 AAGGAAAAAGAGGAGAAGGAAGG - Intronic
911232308 1:95374157-95374179 ATGGAACAAAAGAAAAGGGAAGG + Intergenic
911254665 1:95620317-95620339 ATGAAATTACAGAAAAAGGAAGG + Intergenic
911469057 1:98293822-98293844 ATGGAAAAAGAGAGGAAGAAAGG + Intergenic
911561272 1:99408897-99408919 TTGGAAAAAAAGGAAAAGGATGG - Intergenic
911580214 1:99625427-99625449 ATGCAAAAACAGAACAGGGTAGG + Intergenic
911600599 1:99844351-99844373 ATGGAAGAAGAGAAGAAGAAGGG - Intergenic
911909622 1:103616418-103616440 AGGGAGAAACAGAACAGGGCAGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912027649 1:105198808-105198830 ACGTACAAACAAAACAAGGAAGG - Intergenic
912202455 1:107473453-107473475 ATGGAAAAACTGACCACAGATGG - Intronic
912531526 1:110327345-110327367 CTTTAAAAACAAAACAAGGAAGG + Intergenic
912877188 1:113371734-113371756 AAGGGAAAACAGATCACGGAGGG + Intergenic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913366291 1:118042884-118042906 ATGCATAAACAAAGCAAGGAAGG - Intronic
913527466 1:119707778-119707800 AAGGAAAAACAGAACAAGTGTGG - Intronic
913537127 1:119783815-119783837 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
914883762 1:151568351-151568373 AGGGAAAACAAGAACAAAGAGGG - Intronic
914896481 1:151679505-151679527 AAGGACAAAGAGAACAAGGGAGG + Intronic
914956352 1:152166207-152166229 ATGCACAAACAAAGCAAGGAAGG + Intergenic
915152561 1:153846213-153846235 AAGGAAGCACAGAACAAGCAAGG - Intronic
915208038 1:154285709-154285731 ATGCACAAACAAAGCAAGGAAGG + Intergenic
915453491 1:156023333-156023355 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
915683031 1:157600813-157600835 ATGGAAAAACTGAAAAAAGCTGG - Intergenic
915683039 1:157600934-157600956 ATGGAAAAACTGAAAAAAGCTGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915887004 1:159732753-159732775 ATGGAAAACCAAAAAAAGCAGGG + Intergenic
916029556 1:160863950-160863972 ATGGAAAAAGAGAATAAGAGCGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
917483856 1:175436698-175436720 ATGGAAAACCAAAAAAAGGCAGG + Intronic
917656026 1:177126530-177126552 ATGGAAAACAGGAAAAAGGAAGG + Intronic
918273063 1:182921966-182921988 ATGGAAAACCAAAAAAAGCAGGG + Intronic
918629590 1:186700588-186700610 TTGGAAAAACAAAACAAAAATGG + Intergenic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
918735247 1:188053682-188053704 TGGCAAAAACAGAACAAAGAAGG - Intergenic
919102956 1:193116589-193116611 TTGAAAAAACAGAACAGGGCTGG + Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919992722 1:202719997-202720019 AAGGAAAAAAAAAAAAAGGAAGG - Intergenic
920740053 1:208572639-208572661 ATGGGAAAACATAAAAAGGTAGG - Intergenic
920966124 1:210702317-210702339 AAAGAAAAACAGAAAATGGAGGG - Intronic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921480727 1:215661887-215661909 ATGGCAAAACAGACCCAGGGAGG - Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922569352 1:226624661-226624683 ATGGAAAAATAGAACTTAGAGGG - Intergenic
922646569 1:227292939-227292961 ATAGTAAAATATAACAAGGAGGG - Intronic
922755349 1:228093554-228093576 ATGGAATGGCAGAACCAGGATGG - Intronic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923286911 1:232505081-232505103 ATGAAAAGACTGAAGAAGGAAGG + Intronic
923345489 1:233047591-233047613 ACAGTAAAACAGGACAAGGAAGG + Intronic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924111663 1:240705652-240705674 ATGGAAAAACAGAACATTAATGG + Intergenic
924111665 1:240705671-240705693 ATGGCAAAAGAAAAGAAGGAAGG + Intergenic
924296272 1:242589267-242589289 ATGGAAAAAAATAAAAAGCAGGG + Intergenic
924930587 1:248728767-248728789 ATGCATAAACAAAGCAAGGAAGG + Intronic
1063593082 10:7410727-7410749 AAGGAAAAAAAAAAAAAGGAAGG - Intronic
1063870483 10:10411644-10411666 AGGGAAATACAGAACTAGAATGG - Intergenic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064525279 10:16249671-16249693 AAATAAAAACAGAACAAGAAAGG + Intergenic
1064672907 10:17734069-17734091 ATGGAAATCCAGCAAAAGGACGG + Intergenic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064872705 10:19956659-19956681 ATGGAATAAAAGATCAATGAAGG + Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065095620 10:22278076-22278098 ACGCACAAACAAAACAAGGAAGG + Intergenic
1065850237 10:29781710-29781732 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1067894148 10:50161604-50161626 AGTGAAAAACAGAAGTAGGATGG - Intergenic
1067954697 10:50778657-50778679 AGTGAAAAACAGAAGTAGGATGG + Intronic
1068168357 10:53360118-53360140 ATGGAAAGAGAGTAAAAGGATGG - Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068519682 10:58064451-58064473 ATGGTGCAACAGAACAAGCATGG + Intergenic
1069268421 10:66492955-66492977 ATGTCAAAGAAGAACAAGGAAGG - Intronic
1070267920 10:74922413-74922435 AAGGAAAAAAAGAAGAAAGATGG + Intronic
1070269434 10:74938471-74938493 GTGGAAAAAGAGAAGAAAGAAGG + Intronic
1070303122 10:75219779-75219801 ATGGAAAAAAAAAAAAAGGCTGG - Intronic
1071039493 10:81289010-81289032 AATGAAAAACAGAAAAAGGCAGG + Intergenic
1071067045 10:81648116-81648138 GGGCAAAAACAGAACAAGGGAGG - Intergenic
1071092295 10:81932653-81932675 AAGCAAAAACAGTACAAGAAAGG + Intronic
1071396489 10:85228742-85228764 ATGGAAGAAGGGAACAAGGTTGG - Intergenic
1072088821 10:92106853-92106875 AAAGAAAAAAAGAAAAAGGAAGG + Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072301006 10:94062271-94062293 ATGAAAAAAAACAAGAAGGAAGG - Intronic
1073285119 10:102382838-102382860 ATGGAAAAACAGAACAACAGTGG + Exonic
1073832270 10:107398599-107398621 ATAGAAAAAAAGTAAAAGGATGG + Intergenic
1073998773 10:109346101-109346123 AGAGAAAAATGGAACAAGGAAGG + Intergenic
1074066410 10:110018578-110018600 ATGGGAAAGAAGAACAAGGGTGG + Intronic
1075166335 10:120071288-120071310 ATGGGAACACAGCACCAGGAGGG + Intergenic
1075347745 10:121696700-121696722 ATGGAAAAGCAGATCTTGGATGG - Intergenic
1075606051 10:123809837-123809859 ATGGAAAAACCAAGCAAGGTGGG + Intronic
1075650182 10:124122784-124122806 ATGGAAAATCACAACTAGGATGG - Intergenic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1076269924 10:129143216-129143238 ACAGAAAAAGAGAAAAAGGAAGG + Intergenic
1076826314 10:132971378-132971400 AAGGAAGAACAGAACAGGGAAGG - Intergenic
1077280582 11:1743316-1743338 ATGGACAAACGGAAGATGGATGG + Intronic
1077640388 11:3876291-3876313 ATGGATAAACAGACCTAGGTAGG + Intronic
1077730583 11:4725015-4725037 ATGCAAAAACAGCACCAAGAGGG - Intronic
1077741985 11:4856390-4856412 ATGGAAAACCAAAAAAAGCAGGG + Intronic
1077767311 11:5173381-5173403 ATATAAAAACAGAATAAGAACGG - Intronic
1077827262 11:5824713-5824735 ATGCACAAACAAAGCAAGGAAGG - Intronic
1078714960 11:13831129-13831151 TGGGAAAAACATTACAAGGAAGG - Intergenic
1079717737 11:23770041-23770063 AAGGACAAACAAAACAAGAATGG + Intergenic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1079956046 11:26866051-26866073 AAACAAAAACAGAAAAAGGAAGG + Intergenic
1080417529 11:32082834-32082856 AGAGAAAAATAGAGCAAGGAAGG - Intronic
1080904295 11:36525037-36525059 AAGGGAAAAAAGAACAAGGAAGG - Intronic
1081113819 11:39172676-39172698 ATGGAAGGACAGTACAAGGAGGG - Intergenic
1081504430 11:43700514-43700536 ATGGACAGACAGTAGAAGGATGG - Intronic
1081523042 11:43901432-43901454 ATGGAAAAACAGAAAAGAAAGGG - Intronic
1082768140 11:57184680-57184702 TTGGAAAAATTGAACAAAGAGGG + Intronic
1082826060 11:57579802-57579824 CTCAAAAAACAGAACAAGGCTGG + Intergenic
1082989607 11:59196135-59196157 ATGGAAGAAGAAAACTAGGAGGG - Intronic
1083569752 11:63752669-63752691 GTGGTAAAACAGAAAAAGCAGGG + Intronic
1084581171 11:70024372-70024394 AAGGAAAACCAGGACAAGAACGG + Intergenic
1085485224 11:76858048-76858070 TTAGAAAAAAAGAAAAAGGAAGG + Intergenic
1085513638 11:77100131-77100153 ATAAAAAAACAAAACAAGGCTGG - Intronic
1085923463 11:80986675-80986697 ATGGAAAAGGAGAACAACTATGG - Intergenic
1085983545 11:81755527-81755549 ATGAAAAAACAAAACAAGAAAGG - Intergenic
1086004902 11:82026712-82026734 TTGGAAACAGAGAATAAGGAGGG - Intergenic
1086242697 11:84714908-84714930 ATGGAAAAATAAAAAAGGGAGGG - Intronic
1087300344 11:96426430-96426452 ATGGAAAAACAGAAGAGATAAGG + Intronic
1087344396 11:96952099-96952121 ATGGAAAGATAGAAAAAGAAAGG + Intergenic
1087414706 11:97839306-97839328 ATGGAAGAAAAGGAAAAGGAGGG + Intergenic
1088122459 11:106386310-106386332 ATTTACAAACAGAAAAAGGAAGG - Intergenic
1088375439 11:109135637-109135659 ATGGAAATAGAGTAGAAGGATGG - Intergenic
1088879523 11:113962701-113962723 ATGGAAAAATAGAAAAAGTAGGG + Intergenic
1089789883 11:120934891-120934913 ATGGAAAACCAGAAAAAGCTGGG - Intronic
1090246615 11:125220685-125220707 ATGGAGAAATAGAACAAGGCCGG - Intronic
1090534630 11:127627114-127627136 GTAGAAAAATAGAAGAAGGAAGG + Intergenic
1090981142 11:131723536-131723558 ATGGAAGGAAAGAAAAAGGAAGG - Intronic
1091265653 11:134269325-134269347 AAGGAAAAAAAAAAAAAGGAGGG + Intergenic
1091861761 12:3791761-3791783 AAGGGAAAAATGAACAAGGAAGG - Intronic
1092316000 12:7414022-7414044 ATGGAAAAACAGAAACACCAAGG + Intronic
1092486582 12:8907506-8907528 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1093060276 12:14595098-14595120 GTGGAAAAAAAAAAGAAGGAAGG - Intergenic
1093071766 12:14713232-14713254 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1093073071 12:14727071-14727093 ATGGAAGAAAATAATAAGGATGG - Intergenic
1093075864 12:14758127-14758149 ATAGAAAAACACAAGAAGGAAGG + Intergenic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1093446734 12:19267987-19268009 ATGGAGAAAAAGAACAGGAAAGG + Intronic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1093876962 12:24359994-24360016 AAGGAAGAAAAGAAAAAGGATGG + Intergenic
1093929210 12:24938048-24938070 ATGGGAAAACAGCACATGGGAGG + Intronic
1094039831 12:26111059-26111081 GGGGGAAAACAGGACAAGGAAGG + Intergenic
1094246924 12:28308858-28308880 ATGAAGGAAAAGAACAAGGATGG - Intronic
1094424764 12:30306197-30306219 ATGGTAGAACACAGCAAGGAGGG + Intergenic
1095724810 12:45440156-45440178 ATTGAAAAGCAAAACAAGGGAGG - Intronic
1096564532 12:52467555-52467577 ATGCAAAAGCAAAACAAGCATGG - Intergenic
1096830880 12:54313165-54313187 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1097191594 12:57222013-57222035 ATGGAAAAACAGCACAAGAGAGG + Intronic
1097472791 12:60016563-60016585 AGGGAAAGAAAGAAGAAGGAAGG - Intergenic
1097807541 12:63982243-63982265 AAAGAAAAAAAAAACAAGGATGG + Intronic
1097977177 12:65699033-65699055 ATGGAAAAACAGAACAGAAATGG - Intergenic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1098829024 12:75336280-75336302 AAGGAACAAAAGAACAAAGAGGG + Intronic
1099076045 12:78110582-78110604 ATGTAAAAAAAGAACAAAGCTGG + Intronic
1099224208 12:79949566-79949588 ATGGAGAAATAGAAAAAGAAAGG - Intergenic
1100144400 12:91659537-91659559 GTGGAAAAATAAAGCAAGGAAGG - Intergenic
1100744824 12:97634203-97634225 ATGGCAAAAAAGAATATGGAAGG + Intergenic
1100766169 12:97867864-97867886 ATGGAAAACCAAAAAAAGAAGGG + Intergenic
1100889168 12:99104783-99104805 AGTGATAAACAGAACTAGGAAGG - Intronic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101257759 12:102996590-102996612 GTGCAAAAACAACACAAGGAAGG - Intergenic
1101629444 12:106478766-106478788 AAGGTCAAACAGAACAAGAAAGG + Intronic
1101841104 12:108328102-108328124 AGGGAAAAACAGTAAAAGAAAGG + Intronic
1102669198 12:114602632-114602654 AAGGAAAAAAAGAAAAAGGAGGG + Intergenic
1102698120 12:114815677-114815699 ATGGAAAAACAGAGCTAAGAAGG - Intergenic
1103171700 12:118825889-118825911 AAGGAAAGAGAGAAGAAGGAAGG + Intergenic
1103396986 12:120615256-120615278 TTTGAAAAACAGAACAAAGTTGG - Intergenic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103827318 12:123750128-123750150 ATGGACAGAAAGATCAAGGAAGG + Intronic
1104136328 12:125942840-125942862 AGGGATAAACAGAACATGAAGGG - Intergenic
1105627337 13:22125568-22125590 ATGGAAAAACAGAAGAAAACAGG + Intergenic
1105689878 13:22826734-22826756 ATTGAAAAACAAAACAATGGTGG + Intergenic
1105787919 13:23768067-23768089 AAGGAGAAAGAGGACAAGGAGGG - Intronic
1105981347 13:25519315-25519337 AGGGGAAAACAGATCAGGGAAGG - Intronic
1106005526 13:25766803-25766825 TTGGAAAAACAAAACAAGACTGG - Intronic
1106579411 13:31004720-31004742 AATGAAAAACAGGACAAGAAAGG - Intergenic
1107090280 13:36472118-36472140 ATGGAAAACAAGAAAAGGGAGGG - Intergenic
1107333089 13:39322716-39322738 AGGGAAGAACAGAAAAAAGAAGG + Intergenic
1107738089 13:43419224-43419246 ATTGAAAAAAAGAAAAAGGCTGG + Intronic
1107951620 13:45466982-45467004 ATGGAAAAAAAGAACAAAGAAGG + Intronic
1108108225 13:47036611-47036633 AAGGACAAACAGAACAAGAGAGG - Intergenic
1108379139 13:49840120-49840142 ATGGAGGGAGAGAACAAGGAAGG + Intergenic
1109173320 13:59123536-59123558 ATGGAAAACTAGAACTAGAATGG + Intergenic
1109265774 13:60198638-60198660 ATGGAAAAACAAATCCTGGATGG - Intergenic
1109299384 13:60575185-60575207 AATTAAAAACAGAAGAAGGAAGG + Intergenic
1109303531 13:60614427-60614449 ATGTAAAAAGACAAAAAGGAGGG - Intergenic
1109345608 13:61112071-61112093 GTGGAAAAAGAGAAAAATGAAGG - Intergenic
1109505121 13:63290183-63290205 AAGGAAAAGCAGAAAAAGTAAGG + Intergenic
1109657916 13:65419045-65419067 AACAAAAAACAGAAAAAGGAAGG - Intergenic
1109815578 13:67578604-67578626 ATGGAAAAACAAAGCCTGGATGG - Intergenic
1110330406 13:74265800-74265822 ATGAAAGGAAAGAACAAGGATGG + Intergenic
1110545718 13:76752856-76752878 ATGGAAAAAAACAAAAAGGTTGG - Intergenic
1111668486 13:91299687-91299709 ATGGATACATAAAACAAGGAAGG - Intergenic
1111904709 13:94241641-94241663 AAGCTAAAACAGAAAAAGGAGGG + Intronic
1111932422 13:94525507-94525529 AGGGAAAGACAGAATAAAGATGG - Intergenic
1112687574 13:101849040-101849062 CTGGAAGAACTGAGCAAGGAAGG - Intronic
1112752869 13:102599456-102599478 ATGGATAGAAAGAAAAAGGAAGG + Intronic
1112801474 13:103115177-103115199 AAAGAAAAAAAGAAAAAGGAAGG - Intergenic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113560456 13:111275069-111275091 ATTGCAAAACAGAACAATGGTGG + Intronic
1113775528 13:112943037-112943059 ATGGAAATGCAGAGCCAGGAAGG + Intronic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1114557145 14:23568515-23568537 ATGGGAAAACAACAGAAGGAGGG - Exonic
1115119252 14:29920428-29920450 ATATAAAAACAAAGCAAGGAAGG + Intronic
1115323318 14:32109293-32109315 AAAGAAAAAAAGAAAAAGGAAGG + Intronic
1115543123 14:34441485-34441507 ATGCATAAACAAAGCAAGGAAGG - Intronic
1115642728 14:35345050-35345072 ATGGACAAACAAAACATTGAAGG - Intergenic
1115726322 14:36220635-36220657 ATTGAAAAATAAATCAAGGAGGG + Intergenic
1115924803 14:38419982-38420004 ATGGAAAAACAGACAATGAAAGG + Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116253481 14:42518023-42518045 GTGGAAAAAGAGAACTGGGAAGG + Intergenic
1116453479 14:45090581-45090603 ATGGAATAATAGAAAAAGAATGG - Intronic
1116905341 14:50397783-50397805 CTGGAAACCCAGTACAAGGATGG + Intronic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117474611 14:56081246-56081268 ATGCAAAGACAGCACAATGAGGG - Intergenic
1117782881 14:59252947-59252969 ATGCAAAAAAAGAAAATGGATGG - Intronic
1117797794 14:59411755-59411777 ATGGAAAACAAAAAAAAGGAAGG + Intergenic
1118110822 14:62717336-62717358 TTGGAAAAAGAGAACAAAGTTGG + Intronic
1118963197 14:70554843-70554865 ACGTACAAACAGAGCAAGGAAGG + Intergenic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119816228 14:77570879-77570901 TTGCAAAAACAGAACATGGGCGG + Intronic
1120084559 14:80255471-80255493 ATGGAAGAACAAAACCTGGATGG + Intronic
1120202623 14:81554110-81554132 TTGAAAAAACAAAACAAGGCCGG + Intergenic
1120351163 14:83360178-83360200 ATGTAAAAACAGTATAAAGATGG - Intergenic
1121426111 14:93853288-93853310 AGGGAAAAACCAAACAAGTATGG + Intergenic
1121883551 14:97522412-97522434 ATGGAAGAAGACAAGAAGGAAGG - Intergenic
1122583568 14:102787806-102787828 ATGGAAAAAAAAAAAAAGCAAGG - Intronic
1123669516 15:22641040-22641062 CTGGAAAACCAAAACACGGAGGG + Intergenic
1124108888 15:26768471-26768493 ATTGAAAAACAAAACAATTAGGG - Intronic
1124110364 15:26779745-26779767 GTGGAAAAACAGCCCAAGCAAGG + Intronic
1124525491 15:30447480-30447502 CTGGAAAACCAAAACACGGAGGG + Intergenic
1124562558 15:30788824-30788846 AAGGAAAAAGAAAAGAAGGAAGG - Intergenic
1124773163 15:32560204-32560226 CTGGAAAACCAAAACACGGAGGG - Intergenic
1124835242 15:33190569-33190591 ATGGAAAAACAGGGCAACTATGG + Intronic
1125071104 15:35554119-35554141 ATTGAAACACTGAACAAGAAAGG + Intergenic
1125236502 15:37520271-37520293 ATGTAAAAAGAGAGCAGGGAAGG + Intergenic
1125611993 15:40977634-40977656 ATGAAAAAACAAAACAAAAATGG + Intergenic
1125826768 15:42683058-42683080 ATGGAGAAAAGAAACAAGGAAGG - Intronic
1125983302 15:44023904-44023926 ATGGAAAACGAGACCTAGGAAGG - Intronic
1126183938 15:45812125-45812147 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1126430629 15:48580112-48580134 TTGGAAAAACTGGACAAGGAAGG - Intronic
1126620466 15:50634381-50634403 ATAAACAAACAGAAGAAGGAGGG - Exonic
1127076392 15:55330586-55330608 ATGGAAGAAGAGAAGAAGAAGGG + Intronic
1127355572 15:58195715-58195737 ATGGAAAACCAAAAAAAGCAGGG + Intronic
1128522896 15:68387119-68387141 ATGGAAAAGTAGAAGAAGGTAGG + Intronic
1129040718 15:72684128-72684150 ATGCACAAACAAAGCAAGGAAGG + Intronic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130358660 15:83159611-83159633 ATAGATATACAGATCAAGGAAGG + Intronic
1130397569 15:83516602-83516624 ATGGCAAAGCAGAACAAGGGTGG + Intronic
1130784918 15:87085487-87085509 ATAGAACAAAAGACCAAGGAAGG - Intergenic
1131627798 15:94142163-94142185 ATGCAAAAACTGAAAAAGAAAGG - Intergenic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1132994040 16:2813670-2813692 AAAGAAAAAAAGAAAAAGGAAGG + Intergenic
1133815202 16:9192110-9192132 AAGGAAAAACACAGCAGGGAAGG - Intergenic
1133976019 16:10600443-10600465 ATGCAAAAAGGGATCAAGGAAGG - Intergenic
1134619958 16:15680366-15680388 TTAGAAAAACAGAACAAGACTGG - Intronic
1135093061 16:19537486-19537508 GTGGAATAACTGAACAAGAAAGG + Exonic
1135210310 16:20520300-20520322 AAGGAAAAATGAAACAAGGAAGG + Intergenic
1135618622 16:23933814-23933836 ATCGACAAACAGAAGATGGATGG - Intronic
1136470208 16:30474503-30474525 ATGGAAGTGCAGAACAGGGAAGG + Intronic
1137729417 16:50679086-50679108 ATGGAAATTCAAGACAAGGAAGG + Intronic
1137773982 16:51040766-51040788 AGGGAAGAAAAGAAGAAGGAAGG + Intergenic
1137924738 16:52529676-52529698 ATGCAAAGAAAGAACAAGAATGG + Intronic
1138029332 16:53547399-53547421 ATGGTAAGGCAGAACATGGAGGG - Intergenic
1138142316 16:54579388-54579410 AAGGAAAAACAACACAAAGATGG - Intergenic
1138164412 16:54787451-54787473 AAAGAAAAAAAAAACAAGGAAGG + Intergenic
1138255684 16:55557215-55557237 AAGGAAAAAAGGAAAAAGGAAGG - Intronic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139165784 16:64563577-64563599 ATAGAAAAGAAGAACAAGGCAGG - Intergenic
1139970965 16:70774744-70774766 ATCAAAAAAAAAAACAAGGAAGG - Intronic
1140167428 16:72567429-72567451 AAGTAAAAACAAAAAAAGGATGG + Intergenic
1140695365 16:77527278-77527300 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1140964110 16:79947565-79947587 ATAGATAAATAGAAAAAGGAAGG + Intergenic
1141274337 16:82572695-82572717 ATGTAAAAACTGCACAATGATGG + Intergenic
1141395684 16:83702463-83702485 AGGGAAAGAGAGAGCAAGGAGGG + Intronic
1141612447 16:85190022-85190044 TTGCAAAAACAGAACAAGATAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143206975 17:5149804-5149826 TTGGTAAAAAAGAAAAAGGAAGG + Intronic
1143647316 17:8239109-8239131 AAGGAAAAAGAAAATAAGGATGG + Intronic
1143701132 17:8660996-8661018 AAAGAAAAATAGAAGAAGGAAGG - Intergenic
1144521907 17:15958420-15958442 ATGGGCTAAAAGAACAAGGATGG - Intronic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1144693524 17:17285404-17285426 ATAAAAAAACAAAACAAGGCCGG - Intergenic
1145051089 17:19661573-19661595 ATGGGAAAACAGCACAAAGAAGG + Intronic
1145329686 17:21860990-21861012 ATGGAATAACATAGAAAGGAAGG + Intergenic
1145376705 17:22356389-22356411 ATGGGAAAAGAGATTAAGGAAGG - Intergenic
1146315177 17:31801321-31801343 GTGCAAAAACACACCAAGGAGGG + Intergenic
1146649954 17:34600586-34600608 ATGGCAAAGTAGAACAAGGTCGG + Intronic
1146917905 17:36689942-36689964 ATGCAGAGACAGAACAAGAAAGG - Intergenic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1148001556 17:44390520-44390542 ATGGAAACACACACTAAGGATGG + Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148962205 17:51402747-51402769 AGGGAAAAAAAGAAAAAGAAGGG - Intergenic
1149005618 17:51802274-51802296 GATGAAAAACAGAACCAGGATGG - Intronic
1149008866 17:51834353-51834375 ATGGGAAAACAGGAAAAGAATGG + Intronic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149287341 17:55179312-55179334 ATGGAAAAAAAAATAAAGGAGGG + Intergenic
1149513638 17:57263278-57263300 AAGGGAGAAGAGAACAAGGAGGG - Intronic
1149873376 17:60204058-60204080 TTGGTAAAAAAGAAAAAGGAAGG - Intronic
1150087162 17:62281308-62281330 TTGGTAAAAAAGAAAAAGGAAGG - Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150939361 17:69673833-69673855 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
1150965274 17:69960827-69960849 ATCCAAAAACTGATCAAGGAGGG - Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151228233 17:72662444-72662466 AAGAAAAAAAAGAAAAAGGAAGG + Intronic
1151632444 17:75320098-75320120 ATGAAAAAAAAGACAAAGGAGGG + Exonic
1151933761 17:77248858-77248880 AGGGGAAAACAGAAAAAGAAGGG - Intergenic
1153168778 18:2292158-2292180 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1153705036 18:7736686-7736708 AGAGAAAAACAGAACAGGGCAGG + Intronic
1154113075 18:11586969-11586991 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1155417476 18:25614488-25614510 AAGGAAAAGTAGAAAAAGGAGGG + Intergenic
1155671779 18:28380166-28380188 AATGAAAAAGAGAACAATGAAGG - Intergenic
1155799432 18:30082005-30082027 ATTGAAAAGCACACCAAGGAAGG - Intergenic
1156708628 18:39914336-39914358 ATAGAAAAACATAACAAAGCTGG - Intergenic
1157013740 18:43683329-43683351 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1157089875 18:44624946-44624968 ACGAACAAACAAAACAAGGATGG - Intergenic
1157661073 18:49445428-49445450 AAGGAAATAAAGAACAAGAAAGG + Intronic
1157679540 18:49593694-49593716 ATGGAAAGCCAGAAAAGGGAAGG + Exonic
1157698434 18:49743787-49743809 AAGGAAAACCACAACAATGATGG + Intergenic
1158153873 18:54403558-54403580 AATGGAAAACAGAAAAAGGAAGG - Intergenic
1158279210 18:55802618-55802640 ATGGAAAAAAAAAAAAAGGCAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158619187 18:59016128-59016150 ATGAAAACACAGATCAAGAAGGG + Intergenic
1158678666 18:59546884-59546906 CTAGAAAAACAGAAAAAGAATGG - Intronic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159851321 18:73530075-73530097 ATGGACAAAAAGAATAAGAAAGG + Intergenic
1160776302 19:857925-857947 AGAGAAAAACAGAGAAAGGAAGG + Intergenic
1161906637 19:7161742-7161764 AGGGATGAAGAGAACAAGGAAGG + Intronic
1162077745 19:8199746-8199768 ATAGAAAGACAGAACCAGGCTGG + Intronic
1162310108 19:9901114-9901136 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1162964091 19:14147891-14147913 ATCGAAAAGGAGACCAAGGAGGG + Exonic
1163973366 19:20822243-20822265 ATGCAAAAACAGAGAAATGAAGG - Intronic
1164091238 19:21954657-21954679 ATGGAAAACCAAAAAAAGCAGGG - Intronic
1164184872 19:22856338-22856360 ACAGAAAAACAGAAAAATGAGGG - Intergenic
1164832983 19:31336992-31337014 ATAGAAAAAAAGAAAAAGAAAGG - Intronic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1165307997 19:35013818-35013840 ATGGAGGAACAGGACAGGGAGGG + Intronic
1165438668 19:35811483-35811505 AAGGAAAAAGAAAAGAAGGAAGG + Intronic
1165686753 19:37828610-37828632 ATTGAAACAAAGAACAAAGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166983386 19:46645218-46645240 ATAGAAAAACAGGACGAGCACGG + Intergenic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167429125 19:49444161-49444183 AAAGAAAAAAAGAAAAAGGAAGG - Intergenic
1167591190 19:50405431-50405453 ATGGAAAAACAAAACAGGCTGGG + Intronic
1168383981 19:55947673-55947695 ATGGAAAAACTGAAGATGCATGG - Intergenic
1168659395 19:58154627-58154649 AAGGAAAAAAAGGACGAGGAAGG - Intronic
925466478 2:4110936-4110958 AGGGAAAAAAAGAAGAAGAAAGG - Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
926209621 2:10860410-10860432 ATAATAAAATAGAACAAGGATGG - Intergenic
926346706 2:11953650-11953672 ATGGAAAGAAATAAGAAGGAAGG + Intergenic
926530092 2:14033469-14033491 ATGGAAAACCAGGAAAGGGAAGG + Intergenic
926823126 2:16875508-16875530 AGGGAAAAAATGAACAAGGAAGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927438961 2:23096360-23096382 TTAGAAAAACACAATAAGGATGG + Intergenic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928414824 2:31083462-31083484 ATAAGAAAACAGAACAAGGAGGG + Intronic
928811914 2:35237745-35237767 ATGGAAAAAAGAAACAAGCAGGG + Intergenic
928860499 2:35851757-35851779 GTGGAAAGAAAGAGCAAGGATGG + Intergenic
929073966 2:38061985-38062007 ATGGCAACACTGAACAAAGAAGG - Intronic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929423467 2:41819045-41819067 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
929770683 2:44889075-44889097 ATGGAAAAACACTACAAAGGGGG + Intergenic
930459818 2:51659009-51659031 ATTGAAAAAAAAAACAAGAAAGG - Intergenic
930936885 2:56964097-56964119 ACTGAAAATCAGAACAAGAAAGG - Intergenic
931024290 2:58091750-58091772 ATGAATAAACAGAACAGAGAAGG + Intronic
931117832 2:59183700-59183722 CTAGAAAAAAAGAAAAAGGATGG + Intergenic
931486718 2:62701079-62701101 AGGGAAAGACAGAACTTGGAGGG - Intronic
931591456 2:63888108-63888130 ATGGAGAAACAAAGCAAGGGTGG + Intronic
932358301 2:71084985-71085007 ATGCACAAACAAAGCAAGGAAGG - Intergenic
932698563 2:73977485-73977507 AGGGAAAGAGAGAACAAGGGAGG + Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932977250 2:76618252-76618274 GTGGAAAAACATAACAGAGACGG - Intergenic
933122074 2:78551127-78551149 ATGGAAAGATATAACAAGAAAGG + Intergenic
933265234 2:80174437-80174459 TTGGAAAAACAGCCCAAGGAAGG - Intronic
933269064 2:80214037-80214059 ATGGAAAACAAAAACAAGCAGGG - Intronic
933555805 2:83829018-83829040 AAGGAAAAACAAAACAATGGAGG - Intergenic
933660689 2:84925205-84925227 ATGCACAAACAAAGCAAGGAAGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934138173 2:89018037-89018059 AAGGAAAAAAAGAAAAAGAATGG + Intergenic
934231073 2:90182589-90182611 AAGGAAAAAAAGAAAAAGAATGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934818547 2:97351821-97351843 ATGCACAAACAAAGCAAGGAAGG - Intergenic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934960904 2:98671847-98671869 ATGGAACAACAGAATCAAGAGGG + Intronic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
936908869 2:117569974-117569996 AATGAAAAACAGAAAAAGGCAGG - Intergenic
937406495 2:121634125-121634147 ATGGGAAAACTGAAGAGGGATGG - Intronic
937467474 2:122147316-122147338 AAGAAAAAATAGAACAAGAAGGG + Intergenic
937674240 2:124571876-124571898 ATGGAAAAAAAGCACAATAAGGG + Intronic
937677071 2:124603050-124603072 AAGGAAGAAAAGAAGAAGGAAGG - Intronic
937869114 2:126775202-126775224 ATGGATACCCAGAACAAGGCTGG - Intergenic
938572525 2:132573263-132573285 AGGGAAAAATAGAGGAAGGAGGG - Intronic
938622061 2:133066527-133066549 AGGAAAAAATAGAAGAAGGAAGG - Intronic
938648139 2:133352189-133352211 ATGGAGAAATAAAACAGGGAGGG - Intronic
938700896 2:133878359-133878381 ATGGAGATACAGAACCAGGCAGG + Intergenic
939191360 2:138920263-138920285 TTGGAATAAAAGAAAAAGGAAGG - Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939614659 2:144348872-144348894 AAGGAAAAAAAAAAAAAGGACGG + Intergenic
940043538 2:149385795-149385817 AGGGAAAAAGAGAACAAGAGGGG + Intronic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940568774 2:155404225-155404247 ATGCACAAACAAAACAAGGAAGG - Intergenic
940569442 2:155411345-155411367 ATGCACAAACAAAGCAAGGAAGG - Intergenic
940578456 2:155546182-155546204 AGGGAGAGACAGAACAAGGGAGG + Intergenic
940619042 2:156087578-156087600 ATGGAAAAAAAGAAAATGAAAGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940672266 2:156685338-156685360 ATGGAAAAACAGCTCAAGATTGG - Intergenic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
940867302 2:158830023-158830045 AGGGAAACACAGCAGAAGGAGGG + Intronic
940922256 2:159321721-159321743 ATGGAAACAGAGTAGAAGGATGG + Intronic
941180302 2:162251835-162251857 ATGGAATAGCACACCAAGGAAGG - Intergenic
941479249 2:165985379-165985401 ATGGAAGGAAAGAAAAAGGAAGG + Intergenic
941479254 2:165985415-165985437 ATGGAAGGAAAGAAAAAGGAAGG + Intergenic
941873721 2:170412120-170412142 ATAGAAAAACATTAAAAGGAAGG + Intronic
941964447 2:171287053-171287075 ATGGAAAAAGAAAGGAAGGATGG - Intergenic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942532047 2:176921487-176921509 ATTGAAAAAAAAAAAAAGGAAGG + Intergenic
942648722 2:178144549-178144571 GTGGAAAAAAAAAAAAAGGATGG - Intergenic
942877478 2:180818692-180818714 GTGCAAAAACAGATCAAAGAAGG - Intergenic
943171928 2:184412749-184412771 AAGCAAAAACAGAAAAAAGAGGG - Intergenic
943393306 2:187298612-187298634 ATATAAAAACAGACAAAGGAGGG - Intergenic
943444680 2:187969739-187969761 ATGGAAAAAAAGAAGTAGAAGGG + Intergenic
943795607 2:191989304-191989326 ATGGAAACTCAGACCAAGGATGG + Intronic
943825027 2:192379253-192379275 ATGGAAAGAAAGAGAAAGGAAGG - Intergenic
944208634 2:197183756-197183778 ATGGATAAAGAACACAAGGAGGG - Intronic
944473270 2:200078349-200078371 AAGGACATAAAGAACAAGGAAGG + Intergenic
944630050 2:201614878-201614900 ATGGAAAACAAGAAAAAGCAGGG + Intronic
944642885 2:201745999-201746021 AGGGAAAAACAGAACACTGTTGG + Intronic
944833064 2:203551844-203551866 TTGGAAAAAAAGACCAAGAAGGG + Intergenic
944870234 2:203903775-203903797 AAAGAAAAAGAGAAAAAGGAAGG - Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945195775 2:207236483-207236505 ATGGAGAAAAACAACCAGGAGGG + Intergenic
946076477 2:217077743-217077765 ATGAAAAAGCAGAACAAAGAGGG - Intergenic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946349214 2:219137713-219137735 ATGGAAAATAAGAATAAGAATGG - Intronic
946526966 2:220531042-220531064 ATGGAATAGCAGAAAAAGTATGG + Intergenic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
946866314 2:224044100-224044122 AGGGAAAGAAAGAAAAAGGAAGG - Intergenic
946969797 2:225079244-225079266 ATGGAAAAAAAAAACAAAAAGGG - Intergenic
946996459 2:225397887-225397909 AAGAAGAAACAAAACAAGGAAGG + Intergenic
947154268 2:227145632-227145654 AGAGAACAAAAGAACAAGGATGG - Intronic
947848077 2:233261686-233261708 ATGGAGAAAAGGAACAAGGCTGG - Intronic
947909132 2:233790244-233790266 ATGGAAAGACAGAACAATGCAGG - Intronic
947986433 2:234451636-234451658 AAGGAAAACCAGAACAAGACAGG - Intergenic
948088147 2:235267653-235267675 ATGGGAGAACAGGTCAAGGAGGG - Intergenic
948217600 2:236243417-236243439 ATGGCAACAGAGAACATGGATGG - Intronic
949063802 2:241976911-241976933 AAGGAAGAACAGAAAAAGGATGG - Intergenic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1169913367 20:10665182-10665204 AAGGAAAAAGAGAAAAAGGGAGG + Intronic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1170466251 20:16625086-16625108 TTGGAAAAACAGATTATGGAAGG - Intergenic
1170707568 20:18759059-18759081 ATGAAAAAACAAAAAAAGGCAGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1172320053 20:33989326-33989348 ATGGAAAACAAGAGCAAGGAAGG - Intergenic
1172343878 20:34181487-34181509 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1172382834 20:34511127-34511149 AAAGAAAAACAAAAAAAGGAGGG - Exonic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1172574714 20:35999365-35999387 AGGGAAAAACAGAAGAAAAAGGG - Intronic
1173096050 20:40029574-40029596 ATGGAAGAACAGAGAAAGGGAGG + Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173403584 20:42745744-42745766 ATGGAAAATTAGCATAAGGAGGG + Intronic
1173561035 20:44005938-44005960 TGGGAAAAAAAAAACAAGGAAGG + Intronic
1173643671 20:44620428-44620450 ATGGAACCAGAGAACAAAGAAGG + Intronic
1173917890 20:46723138-46723160 ATGGAAATATAGAAGAAGAATGG - Intronic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1175164261 20:57031791-57031813 ATTTAAAAAGAGAAAAAGGAAGG - Intergenic
1175344133 20:58259356-58259378 AGGAAAAAACAAAAGAAGGAAGG + Intergenic
1175469567 20:59217734-59217756 GTAGAAAAAAAGAACATGGAGGG + Intronic
1176786111 21:13258360-13258382 AAGGAAAAACAGTTCAAGAAGGG - Intergenic
1176890120 21:14306033-14306055 ATGGAAAAAAAGCACAAGCAAGG - Intergenic
1177097135 21:16849855-16849877 GGGGAAAAACAGAAAAAGGTAGG - Intergenic
1177180386 21:17738694-17738716 ATTGAAGAACAGAAGATGGAAGG + Intergenic
1177984128 21:27952070-27952092 AAGGAAAAACAGCTCAAGAAGGG - Intergenic
1178096240 21:29218784-29218806 ATGAAAGAACAGGACAATGATGG - Intronic
1178256263 21:31055190-31055212 AGAGACAAACAGAAAAAGGAAGG + Intergenic
1178663780 21:34528952-34528974 ATGGAAAAAAAAAAAAAGAACGG + Intronic
1179482412 21:41686550-41686572 ATGGAAAAAGGGAGGAAGGAAGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180121123 21:45748904-45748926 ATGGAAAAGCAGCACAGAGAGGG - Intronic
1180252663 21:46599448-46599470 ATGGAAACACTGGACAATGATGG - Exonic
1180607153 22:17067352-17067374 AGGGAAAAAAAAAAAAAGGAAGG + Intergenic
1181090488 22:20469212-20469234 ATGGAAACACAGAACAGAGATGG + Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1181779638 22:25183502-25183524 AAGGAAGGAGAGAACAAGGAAGG - Intronic
1182857160 22:33527893-33527915 ATGGAAAAGCAGAACAACTTTGG + Intronic
1182961127 22:34476252-34476274 TTGGAAAAAAAAAAAAAGGATGG + Intergenic
1183499311 22:38168940-38168962 ATGGACAAAGGGAAGAAGGAAGG - Intronic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
1184168868 22:42746965-42746987 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1184950463 22:47838592-47838614 ATGGGTAAATGGAACAAGGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185035534 22:48474779-48474801 AAGGAAAAGCAGAAAAAGCAGGG + Intergenic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949217806 3:1591299-1591321 ATGACAAAATAGCACAAGGAAGG + Intergenic
949741063 3:7235195-7235217 ATGGAAATACAAAGGAAGGAAGG - Intronic
949969702 3:9394772-9394794 ATAGAACAACAGACCATGGAAGG + Intergenic
950119106 3:10470079-10470101 ATGGGAAAACAGACCTGGGAGGG + Intronic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
950354985 3:12399666-12399688 AGGGAAAAAAGGAAAAAGGAAGG + Intronic
950765527 3:15270257-15270279 ATGGCAAGTCAGAACCAGGAAGG + Intronic
950808855 3:15632379-15632401 AGGGAACAGCAGAACCAGGAAGG - Intronic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951472589 3:23072044-23072066 ATGTAAAAAGAGAACTAAGAGGG + Intergenic
951682064 3:25305273-25305295 AAGGAAAAAGAGAAAAAGGCTGG + Intronic
951951657 3:28205022-28205044 ATGGAAATACAAAAAAAGGAGGG + Intergenic
952061882 3:29521077-29521099 ATGGAAAAAAATAATAAGGCAGG - Intronic
952241662 3:31536427-31536449 ATGGAAAAAGAGGTCAGGGAAGG - Intronic
952915737 3:38239748-38239770 CTGATAAAACAGTACAAGGAAGG - Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953090449 3:39719405-39719427 ATGGAAAAAAAGAACATTAAAGG - Intergenic
953333875 3:42077576-42077598 ATGGAAAAACAGTCCAGGCATGG - Intronic
953516172 3:43593929-43593951 ATGGAAAACAAAAACAAGCAGGG + Intronic
953539574 3:43804699-43804721 ATGGAAAACAAAAACAAGCAGGG - Intergenic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954488645 3:50879447-50879469 ATGGAAAACAAAAAAAAGGAAGG + Intronic
954525194 3:51263739-51263761 ATGGAAAACCAAAAAAAGCATGG + Intronic
954563332 3:51577668-51577690 ATGGAAAACCAAAAAAAGCAGGG - Intronic
955376409 3:58400939-58400961 ATGGAAAAACAGACCCAGTTTGG + Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955959673 3:64327429-64327451 AGGAAAAAAGAGAAAAAGGAGGG + Intronic
955962764 3:64357897-64357919 AGGGAAGAACAGAGGAAGGAAGG - Intronic
956430277 3:69179346-69179368 AGGGAAAGACCAAACAAGGAGGG - Intronic
956457129 3:69433413-69433435 GTGTAAAAACAGGACAAGGAGGG + Intronic
956629476 3:71301336-71301358 AAAGAAAAACAGAGCAAAGATGG + Intronic
957419191 3:79947053-79947075 CTGGAAAAAAAGAACCTGGATGG - Intergenic
957497055 3:81006380-81006402 ATTTACTAACAGAACAAGGAGGG - Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
958044331 3:88265607-88265629 ATCAACAAAAAGAACAAGGAAGG - Intergenic
958526846 3:95271944-95271966 ATGGATAAATAGAAAAAGAAAGG - Intergenic
959092144 3:101914738-101914760 ATAGAAACAGAGCACAAGGATGG - Intergenic
959213272 3:103416879-103416901 ATTGAAAAAGTAAACAAGGAAGG + Intergenic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
959659590 3:108851645-108851667 AAGGAAAAACAGTTCAAGTAAGG - Intronic
959800158 3:110484267-110484289 ATGGAAAAATAATAGAAGGAAGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960062218 3:113335054-113335076 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
960066164 3:113375437-113375459 ATGGAGAAAGACAAAAAGGATGG + Intronic
960099245 3:113721636-113721658 AAGAAAAACAAGAACAAGGAGGG + Exonic
960246784 3:115408522-115408544 ATGGAAAAAAGAAAGAAGGATGG + Intergenic
960608250 3:119530465-119530487 CTGGAAACACAGAACAAGTCTGG + Intronic
960983835 3:123257992-123258014 ATTGAAAAAAAAAAAAAGGAAGG + Intronic
961609977 3:128128945-128128967 ATGGAAATACAAGAAAAGGAAGG - Intronic
962335432 3:134526373-134526395 ATAGCAAAACAGACCAAGCAGGG - Intronic
962426855 3:135277865-135277887 ATGGAAAAAAAAAAAAAGGTGGG + Intergenic
962506243 3:136048992-136049014 ATGGTAAAACGGAAACAGGAAGG - Intronic
962833942 3:139170294-139170316 ATGGAAAACAAAAACAAGCAGGG - Intronic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963341909 3:144046592-144046614 ATAGAAATAAAGAAAAAGGATGG - Intronic
963353163 3:144177336-144177358 AAGCAAAAACAGAAAAAGCAAGG - Intergenic
963759716 3:149274980-149275002 TTGGAAAAAAAAAAAAAGGAAGG - Intergenic
964726323 3:159817879-159817901 AAGGAAAATCAAAACAATGAGGG - Intronic
964763551 3:160157017-160157039 ATGAAAAAAAAAAAAAAGGAAGG + Intergenic
964778124 3:160303042-160303064 ATAGAAAACCAGAAGAAGAATGG - Intronic
965495090 3:169388410-169388432 ATGCACAAACAGAACAAAGAAGG + Intronic
965540837 3:169869959-169869981 ATAAAAAAACAGAAAAAGAAAGG - Intergenic
965726425 3:171721307-171721329 ATAGAAAGAAAGAGCAAGGAAGG + Intronic
966473244 3:180316326-180316348 ATAGAAAAATAGAAAAAGAAGGG - Intergenic
966630494 3:182069182-182069204 AAGGAAAAAAAGAAAAAGGAAGG - Intergenic
967391607 3:188961708-188961730 AGGAGGAAACAGAACAAGGAAGG - Intronic
967443450 3:189536661-189536683 ATTTAAAAACAGAAAAGGGATGG - Intergenic
967562261 3:190930303-190930325 ATGGAAACTCAGAACAGTGAGGG - Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967752793 3:193133380-193133402 ATAGAAAAACAGAGCAATTAAGG - Intergenic
968109831 3:196035672-196035694 AAGGAAAAAAAAAAAAAGGAAGG + Intronic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
970161284 4:13192066-13192088 ATGGAAAAACAAAAGATAGAAGG + Intergenic
970228545 4:13884942-13884964 ATGGAAAAATAGAATATGGCTGG - Intergenic
970413720 4:15835967-15835989 AGGGAAAAAAAGAGAAAGGAAGG + Intronic
970896788 4:21112787-21112809 TTAGAAAAACAGAAAATGGAAGG + Intronic
971415081 4:26418565-26418587 ACGGAAAAAAAGAACCAAGAAGG - Intronic
971542558 4:27838258-27838280 AGGTAAAAACTGAACAAAGAAGG + Intergenic
971661707 4:29426169-29426191 AGGAAAAAAGAAAACAAGGAAGG - Intergenic
971903015 4:32686860-32686882 TTGTAAAAATAGAACAAAGATGG - Intergenic
971909433 4:32776387-32776409 AAGGAAAAAAAGTACAAGGATGG - Intergenic
972022142 4:34328340-34328362 ACGGAAAATTAGTACAAGGAAGG + Intergenic
972047229 4:34681702-34681724 AAAGAAAAACAGAACAAGGGTGG - Intergenic
972580618 4:40392786-40392808 ATGAGAAGAGAGAACAAGGATGG + Intergenic
973313828 4:48738965-48738987 ATGGAAGGAAAGAACAAGGTTGG + Intronic
973689741 4:53414543-53414565 AAAAAAAAACAGAACAAGGGGGG + Intronic
973794950 4:54415829-54415851 ATGCACAAACAAAGCAAGGAAGG + Intergenic
974554089 4:63420795-63420817 AAGGAAGAAAAGAAGAAGGAAGG - Intergenic
974609666 4:64199979-64200001 ACAGAAAAACAGAACAAAAAAGG + Intergenic
974831564 4:67195589-67195611 ATAGACCAACAGAACAAGGTTGG + Intergenic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
975035670 4:69677275-69677297 ATAGACATACAGAAGAAGGATGG + Intergenic
975140661 4:70915315-70915337 ATGCACAGACAAAACAAGGAAGG + Intronic
975242089 4:72071865-72071887 GTGGAAAAAGAGAAAAATGAAGG - Intronic
975658655 4:76666730-76666752 AAGGAAATACAGAGCAAGCAGGG + Intronic
976086248 4:81410030-81410052 AAGGAAGGAAAGAACAAGGAAGG - Intergenic
976558120 4:86472995-86473017 ATGCACAAACAAAGCAAGGAAGG - Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976835870 4:89372793-89372815 ATAGAATTCCAGAACAAGGAAGG - Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977335794 4:95697254-95697276 ATGAAAACACTGAACTAGGAAGG + Intergenic
977379886 4:96258990-96259012 ATGAAAAAACATACCAAAGAAGG - Intergenic
977415794 4:96731711-96731733 GGAGTAAAACAGAACAAGGAAGG - Intergenic
977786014 4:101035657-101035679 AAAGAAAAAAAGAGCAAGGAAGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979056655 4:116003402-116003424 AGGGAACAAGAGAGCAAGGAAGG + Intergenic
980094461 4:128474999-128475021 AAGGAAAAAAAGAACTAGGAGGG + Intergenic
980688710 4:136263111-136263133 ATCAAAAAAAAGGACAAGGAGGG + Intergenic
980962773 4:139492799-139492821 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
980984807 4:139684954-139684976 GTTGAAAAACTGAATAAGGAGGG - Intronic
981409782 4:144416215-144416237 AGAGAAAAACAGAATAAAGAAGG + Intergenic
981834020 4:149033900-149033922 ATGAAACAAAAGAAAAAGGATGG + Intergenic
982445760 4:155489161-155489183 AGGGAAAATGAGAACAAGGAAGG - Intergenic
982502743 4:156178247-156178269 ATAGAAAAATAGAATAAGAATGG - Intergenic
982785465 4:159531860-159531882 ATGGAAAAACAAAAAAAAGCAGG - Intergenic
982904047 4:161046198-161046220 ATTGAAAGAAAGAACAAAGAAGG - Intergenic
983249327 4:165327158-165327180 ATGGTAGACCAGAAAAAGGAAGG + Intergenic
983274365 4:165599742-165599764 AAGGAGAAAAAGAACAAGCAGGG - Intergenic
983731550 4:171000191-171000213 AGGAAAAAAGAGAGCAAGGAAGG - Intergenic
983899217 4:173115196-173115218 ATGGAAAGACAGAAAAAAGCAGG + Intergenic
984303147 4:177950180-177950202 ATGTAAAAAAAAAAAAAGGAAGG - Intronic
984470986 4:180173254-180173276 GTAGAAAAACAGAACAAAAAAGG + Intergenic
984791293 4:183617262-183617284 AAAGAAAAAGAGAAGAAGGAAGG - Intergenic
984981864 4:185289825-185289847 ATGGAATAACAAAATAAGAAAGG - Intronic
985167478 4:187112403-187112425 AGGGTAAAAGAGATCAAGGATGG - Intergenic
985236863 4:187884654-187884676 ATTAAAAAACAGAAAAAAGAAGG - Intergenic
985237685 4:187894096-187894118 AAGAAAAAAAAGAAAAAGGATGG + Intergenic
985473567 5:63917-63939 ATGGAAAACAAAAACAAGCAGGG - Intergenic
985797395 5:1973118-1973140 AAGGAAGAAGAGAAGAAGGAAGG - Intergenic
985888587 5:2699078-2699100 CTGGCAACACAGAGCAAGGATGG + Intergenic
986536227 5:8790530-8790552 AAGGAAAAACAGAACATTGCAGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986886692 5:12246521-12246543 ATGGGAAAACAGAAGACAGATGG + Intergenic
986901179 5:12435738-12435760 ATGAAAAAAGAGGAAAAGGAAGG - Intergenic
987350901 5:17020895-17020917 ATGCACAAACAAAGCAAGGAAGG + Intergenic
987427331 5:17788220-17788242 ATGAAAAAAGAGAAGACGGAGGG - Intergenic
987451534 5:18090071-18090093 ATGGAAAAATAAAACAAAAAGGG + Intergenic
987510119 5:18826175-18826197 ACAGAATAACAGAACAAGCATGG - Intergenic
987635977 5:20542153-20542175 ATGGAAAAACTGAACTCTGATGG - Intronic
987841706 5:23231060-23231082 ATGCACAAACAAAGCAAGGAAGG + Intergenic
987869583 5:23597876-23597898 AGGGAAAAATAGAAAAAGAATGG + Intergenic
987938823 5:24505240-24505262 AAGGAAAATCTGAACATGGAGGG + Exonic
988092231 5:26558642-26558664 ATGAAAAAAGAAAAAAAGGAAGG + Intergenic
988253342 5:28789493-28789515 AGAGAAGAACAGAAAAAGGAAGG + Intergenic
988305022 5:29482970-29482992 ATGGTAAAAAAGGACAAAGAAGG + Intergenic
988668038 5:33351983-33352005 ATGGAAAAATAAAAAAAGCAAGG - Intergenic
988935451 5:36078088-36078110 ATAGTAAAAGAGAACAAAGAAGG - Intergenic
989240171 5:39194533-39194555 AAAGAAAGACAGAAAAAGGAAGG + Intronic
989344281 5:40411686-40411708 ATGGAAAAAGGGAACCAAGATGG + Intergenic
989439190 5:41450180-41450202 AAGGAAGAACAGAACTGGGAGGG + Intronic
989536109 5:42565432-42565454 AAGGAAAAACATAACAATCATGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990056773 5:51591410-51591432 ATGGAAAAAGTGAATAAAGATGG + Intergenic
990156937 5:52888236-52888258 AAGCAAAAACATAAGAAGGAAGG + Intronic
990224058 5:53629702-53629724 ATGGAAAGAAAAAAAAAGGAGGG - Intronic
990756538 5:59078075-59078097 ATGGAGAGAAACAACAAGGAGGG - Intronic
991087125 5:62657925-62657947 ATGGAAAAACAAAAAAAGGCAGG + Intergenic
991577947 5:68124373-68124395 ATGAAAAAACAGAAAAAAGCAGG + Intergenic
991673351 5:69069184-69069206 ATGAAAAAAAAGCCCAAGGAAGG - Intergenic
992321477 5:75617305-75617327 TTGGAAAAACAGAACCACAAAGG - Intronic
992728881 5:79638092-79638114 ATGTAAGAACAGAAGAAGGCTGG - Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
993104500 5:83584099-83584121 ATGCCAAAATAGAACAAGAATGG + Intergenic
993342842 5:86745967-86745989 ATGGAAAAAAATAACCAGAAAGG - Intergenic
993418795 5:87673586-87673608 ATGGAGAAACGGAAAAAGCAAGG - Intergenic
993848533 5:92975980-92976002 ATTGTAAAACAAAACAAAGAGGG + Intergenic
994040649 5:95256203-95256225 AATGAAAAAAAGAATAAGGAAGG + Intronic
994102603 5:95910251-95910273 ATTGAAAAAAATAATAAGGAGGG + Intronic
994133578 5:96260018-96260040 ATGGAAAAAAAAGAAAAGGATGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994598289 5:101867736-101867758 ATGGAAAAACAGAAATCAGAGGG + Intergenic
994633022 5:102309145-102309167 AAGGAAAGAAAGAACAAAGAAGG + Intergenic
995203095 5:109447975-109447997 ATGGAAAAACAGATCCATGCTGG + Intergenic
995264996 5:110149210-110149232 ATGGGAATACAAAACAAGCAGGG - Intergenic
995298126 5:110543059-110543081 ATGCACAAACAAAACAAGGAAGG - Intronic
995396582 5:111693272-111693294 TTGGGAAACAAGAACAAGGATGG + Intronic
995421465 5:111972222-111972244 AAGGAAAAAAATAACAAGTATGG + Intronic
996120395 5:119665408-119665430 ATGCACAAACAAAGCAAGGAAGG + Intergenic
996195687 5:120604309-120604331 ATGATAAAAAAGGACAAGGAAGG - Intronic
996317254 5:122174086-122174108 ATGGCATAACAGAGTAAGGAGGG - Intronic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996778391 5:127157926-127157948 AATGGAAAACAGAAAAAGGAAGG - Intergenic
996936957 5:128960530-128960552 ATGGAAAACAAAAAAAAGGAGGG - Intronic
997085462 5:130792508-130792530 ATGGAAATAGAGTAGAAGGATGG + Intergenic
997130474 5:131271392-131271414 AAGAAAAAACAGAACAAAAAGGG + Intronic
997137963 5:131346321-131346343 ATGGAAAACAAAAAAAAGGAGGG + Intronic
997816634 5:137025672-137025694 AAAGCAAAACAAAACAAGGAAGG + Intronic
997992681 5:138559064-138559086 ATGGAAAAACATCACAAGATTGG + Intronic
998165873 5:139843299-139843321 AGGGAAAAACAGGGCAAGGGAGG - Exonic
998297217 5:140982991-140983013 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
998875762 5:146597506-146597528 ATGGAAAGAGAGAGCAAGAAAGG - Intronic
998939488 5:147265648-147265670 ATGGAAAAACATAAGAAGCTTGG - Intronic
999665213 5:153905678-153905700 AAAGAAAAACAGAAGAATGATGG + Intergenic
999938853 5:156518158-156518180 ATGGAAAAACAGAAAAAAGCAGG + Intronic
1000059981 5:157646038-157646060 CTGGAAAAACAAACCAATGATGG + Intronic
1000114124 5:158137115-158137137 AAGGAAAAAGAGAGGAAGGAGGG - Intergenic
1000604452 5:163313268-163313290 ATAGAGAAACAGAACAGGGCAGG + Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000698500 5:164419097-164419119 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1000955199 5:167534925-167534947 ATAGAAAAACAAAAGAAAGAAGG - Intronic
1001023232 5:168201638-168201660 ATTGAAATACTGAACAATGATGG - Intronic
1001445143 5:171777050-171777072 AAGGAAAAAAAAAAAAAGGAGGG - Intergenic
1001570585 5:172728044-172728066 ATGGAAAAATAAAACAAGGAGGG + Intergenic
1001933762 5:175690554-175690576 ATGGAAAGAAAGAAAAAGGCAGG - Intergenic
1002598250 5:180338303-180338325 ATGGAAAAATAGAAGAAGCAAGG - Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003293406 6:4802774-4802796 AAAGAAGAACAGAAAAAGGATGG - Intronic
1003359254 6:5408691-5408713 ATGAACAAACGGAAGAAGGAAGG + Intronic
1003583240 6:7361708-7361730 TAGGAAAATCAGAACTAGGAAGG + Intronic
1003735826 6:8876649-8876671 GTGGAATAACAATACAAGGAAGG + Intergenic
1003819269 6:9877787-9877809 CTGGAAACAAAGAACAAGGGTGG + Intronic
1005167588 6:22942290-22942312 ATAGAAAAACAGAAGAATGAGGG + Intergenic
1005431402 6:25761647-25761669 ATGGGAACACAGAACTAGAAAGG + Intronic
1006079569 6:31557675-31557697 ATGGGAATAAAGAATAAGGATGG + Exonic
1006244019 6:32713981-32714003 TTGGAAAAAAAGAACAAAAAAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1007126396 6:39429386-39429408 ATGGAAAAACAAATCAAGATGGG - Intronic
1007434929 6:41803598-41803620 ATTAAAAAACAAAACAAGGCTGG - Intronic
1007811182 6:44486861-44486883 ATGGGAGCCCAGAACAAGGAGGG - Intergenic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008014003 6:46497457-46497479 ATGGAAAAGGAGAAGAAGTATGG - Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008041652 6:46807720-46807742 AGAGGAAAACAGAAGAAGGAGGG + Intronic
1008240491 6:49104072-49104094 ATGGAATAACAACATAAGGAAGG + Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008416270 6:51244424-51244446 ATGGAGAAAAAGAGCAATGAAGG - Intergenic
1008784617 6:55152032-55152054 ATGGAACAACAGAGCCTGGATGG - Intronic
1008862371 6:56164521-56164543 ATGGAAACAGACAACAAGCATGG + Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009265425 6:61548698-61548720 ATTGAAAAACAGAAAACAGACGG + Intergenic
1009793931 6:68441673-68441695 ATGGAAAGACAAAATTAGGAAGG + Intergenic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1010711513 6:79180630-79180652 ATGGAAAAAAAGAACTAAGATGG - Intergenic
1011216470 6:85011309-85011331 ATGCAAAAAGATAGCAAGGAGGG - Intergenic
1011288828 6:85753953-85753975 ATGGAAAACCAAAAAAAGGCAGG + Intergenic
1011471517 6:87712658-87712680 ATGGAGAAACAAAACAGTGAGGG + Intergenic
1011701582 6:89960156-89960178 CTGGAAGAACAGAAAAGGGAAGG - Intronic
1011710245 6:90045724-90045746 ATGTAAAAACACTAAAAGGATGG + Intronic
1011812083 6:91144402-91144424 AGGGAAGCACAGAAGAAGGAAGG - Intergenic
1011826562 6:91313165-91313187 ATAGAAAAACACAACAGAGATGG - Intergenic
1011912179 6:92454209-92454231 ATAGGAAAAAAGAAAAAGGAAGG + Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012768474 6:103398467-103398489 AAGAAAAAAGAGAACAAAGATGG - Intergenic
1012849019 6:104424551-104424573 AGGGAAACATAGAACACGGAAGG - Intergenic
1013541421 6:111114087-111114109 ATGGAAATACAAAAAAAAGAGGG - Intronic
1013629117 6:111968097-111968119 ATGGAAAAAGTAAACAAGAAAGG - Intergenic
1013739864 6:113269826-113269848 ATGGAAACACAAAACTTGGATGG + Intergenic
1013807125 6:114008450-114008472 ATGCACAAACAAAGCAAGGAAGG + Intronic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1014229473 6:118887186-118887208 TTGAAAAAAAAGAACAAGGTTGG + Intronic
1014842680 6:126239034-126239056 ATGGAAAACAAAAAAAAGGAAGG - Intergenic
1014845463 6:126270328-126270350 ATGCAAATATAGAATAAGGATGG + Intergenic
1015033125 6:128620351-128620373 ATGGAAAAACAGAACAATGTAGG + Intergenic
1015079666 6:129208678-129208700 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1015360504 6:132333778-132333800 ATGGCAAAACAGACCAGGCAAGG + Intronic
1015387969 6:132647828-132647850 AGGGAAAAAGATAAAAAGGAAGG - Intergenic
1015464542 6:133534026-133534048 ATGGAAATAAAGAACAAGGATGG + Intergenic
1015902416 6:138081812-138081834 AGGCAAAAACAGTACATGGAAGG + Intergenic
1016131997 6:140485484-140485506 AGGGAAAAACAGATCATGGATGG - Intergenic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1016848950 6:148597099-148597121 CTGCAAAACCATAACAAGGATGG + Intergenic
1016931627 6:149416563-149416585 ATGGAACAACAGAGCCTGGATGG + Intergenic
1017006456 6:150030983-150031005 TTGGAAAATCACAACATGGATGG - Intergenic
1017284516 6:152658695-152658717 ATGGAAAAAAAAAAAAAGGATGG + Intergenic
1017327371 6:153154848-153154870 ATAGCAAAACTGAAAAAGGAAGG - Intergenic
1017378285 6:153797090-153797112 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1017604791 6:156122458-156122480 ATGGGAAAACAGTTCAAAGAAGG - Intergenic
1017669582 6:156756991-156757013 AGGGAAAGAAAGAAAAAGGAAGG + Intergenic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1017866296 6:158446393-158446415 AAAGAAAAACAGAACAAAAAGGG - Intronic
1018291452 6:162296093-162296115 AAAGCAAAAGAGAACAAGGAGGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018676645 6:166227922-166227944 ACTGTAAAACAGAACACGGAGGG - Intergenic
1018794188 6:167173091-167173113 AAAGAAAAAGAAAACAAGGAAGG + Intronic
1019392982 7:799984-800006 AAAAAAAAACAGAAAAAGGAAGG + Intergenic
1020178348 7:5900873-5900895 ATTGAAAAACAGAGTAAAGATGG + Exonic
1020304577 7:6824126-6824148 ATTGAAAAACAGAGTAAAGATGG - Exonic
1020404231 7:7813821-7813843 ACTGAACAACAGTACAAGGAAGG - Intronic
1020409878 7:7880065-7880087 ATGGAAAAAAATAACTGGGAAGG - Intronic
1020587128 7:10082749-10082771 ATTGAAAAACAGCACATGGTAGG - Intergenic
1020828426 7:13062219-13062241 TTGGAAAAATAAAATAAGGAAGG + Intergenic
1021112443 7:16710637-16710659 AGGGAAGAAGAGAAGAAGGAAGG + Intergenic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021706122 7:23369536-23369558 ATGGACAAACAGAACCAGTTTGG + Intronic
1021838421 7:24703241-24703263 ATGCAAAAACAAAACAACTATGG - Intronic
1021881306 7:25097704-25097726 ATGGCAAAACAAAACAAAAATGG - Intergenic
1021957541 7:25841154-25841176 ATGGAATGCCAGAACAAGCATGG + Intergenic
1022294366 7:29036035-29036057 ATGGAAAAACTGAAGAAGTGGGG - Intronic
1022385317 7:29893412-29893434 ATGGAAATATAGAACAATGAAGG + Intronic
1022464670 7:30645519-30645541 GAGGAAAAAGAAAACAAGGAAGG - Intergenic
1022712830 7:32867779-32867801 ATGGAAAAACAATGCAAGGTAGG + Intergenic
1022848053 7:34231175-34231197 ATGGAAAAACATTCCATGGATGG - Intergenic
1022984350 7:35636243-35636265 ATTTAAAAACATAACAAGGTAGG - Intronic
1023055608 7:36287515-36287537 ATGGTAAACAAGAACAAGGCTGG - Intronic
1023213024 7:37829083-37829105 ATGGAAAAACAGAAAAACTGGGG - Intronic
1023369068 7:39494713-39494735 ATGGAAAAAAAGAAAAAAGGTGG + Intergenic
1023766889 7:43520250-43520272 ATGGAAAAAGAGATAAAGAAGGG - Intronic
1024329228 7:48139828-48139850 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1024354652 7:48402192-48402214 ATGGAAGAAATGAAGAAGGAGGG + Intronic
1024684418 7:51729860-51729882 AGGGAAAAAAAGACCCAGGAAGG + Intergenic
1024785161 7:52898954-52898976 TTGGAAGAAAAGCACAAGGATGG + Intergenic
1025152673 7:56572250-56572272 ATGGAAATAGAGTAGAAGGATGG - Intergenic
1025204176 7:56982155-56982177 ATTGAAAAAAAAAAAAAGGATGG + Intergenic
1025806702 7:64839588-64839610 ATGGACAAAAGGAAAAAGGAGGG + Intergenic
1025847838 7:65216760-65216782 AAAGAAAAAAAGAAAAAGGAAGG - Intergenic
1026079399 7:67204491-67204513 ATAAAAAAAGAGAAGAAGGAAGG - Intronic
1026152826 7:67802674-67802696 ATGCAGAAACAGAGCAATGAGGG - Intergenic
1026588884 7:71679869-71679891 AGGGAAAAAGAAAAAAAGGAAGG - Intronic
1027357348 7:77370905-77370927 AGGGAAAACCAAAACAAGTATGG - Intronic
1027400722 7:77803283-77803305 TTGCAAAAACAGTACAAGAAAGG + Intronic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1027633060 7:80632267-80632289 AAAAAAAAACAGAACAAGAATGG + Intronic
1027696063 7:81411936-81411958 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1028198789 7:87936385-87936407 ATGGTAAAACTGAAGAAGCAGGG + Intronic
1028262473 7:88683462-88683484 TAGGAAAAACAGAACTAGAAAGG - Intergenic
1028458047 7:91060223-91060245 ATGGAAAAAAAAAAAAAGGCAGG - Intronic
1028967422 7:96817666-96817688 AAGGCAATACAGAAAAAGGAAGG + Intergenic
1029245684 7:99199299-99199321 ATTGAAAAAAAGAACAAAGCTGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030060997 7:105621219-105621241 ATTGACAAAAAGAAGAAGGAAGG - Intronic
1030289386 7:107857189-107857211 AGTGAAAAACAGGACAAGGGTGG + Intergenic
1030314442 7:108099601-108099623 ATGGAAACACAGAACCACAAAGG - Intronic
1030369132 7:108677086-108677108 ATGGAAAGAGAGTAGAAGGATGG - Intergenic
1030832694 7:114245213-114245235 GAGGAAAAAGAGAGCAAGGATGG - Intronic
1030880121 7:114867472-114867494 ATGACAAAAGAGAAGAAGGAGGG - Intergenic
1030965789 7:115991544-115991566 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1031275398 7:119714222-119714244 TTACAAAAAGAGAACAAGGATGG + Intergenic
1031536686 7:122942448-122942470 ATGGAAAAAAAAAACAAAAAAGG - Intergenic
1032156137 7:129469886-129469908 ATGGAACATCAGAACCAGAAGGG + Intronic
1032252649 7:130271296-130271318 ACGCACAAACAAAACAAGGAAGG + Intronic
1032591871 7:133199430-133199452 ATTAAAAAACAAAACAAAGATGG - Intergenic
1032782088 7:135171492-135171514 AGGGAGAAACAGAACAGGGCAGG - Intergenic
1032914444 7:136473642-136473664 CTGGAGAAACCTAACAAGGAAGG - Intergenic
1032918972 7:136524773-136524795 ATGTAAATACAGAAAAGGGATGG + Intergenic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1033421183 7:141205918-141205940 ATGGAAACAGAGACCAAGGAAGG - Intronic
1033519354 7:142145373-142145395 AAGGAAAAAGGGAAGAAGGAAGG - Intronic
1033611303 7:142965522-142965544 ATGGAGAAACAGATCATGGGGGG + Intergenic
1034735359 7:153424326-153424348 ATGGGAAAACAACACAAAGAGGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035836166 8:2754550-2754572 AAGGAAAAAAAGAAGAAGAAGGG + Intergenic
1035893884 8:3375387-3375409 ATGGAAAAAAAGAGAAAAGATGG - Intronic
1037224410 8:16567693-16567715 TGGGAAACACAGAAAAAGGAAGG + Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1038992093 8:32878950-32878972 ATGGAAATACAGGAAAAGGGTGG - Intergenic
1039147598 8:34466123-34466145 AAGGAAAAACAAAAAAAGAAAGG - Intergenic
1039413700 8:37376190-37376212 ATTGAACAACAGAATAAGGGAGG + Intergenic
1039480289 8:37868123-37868145 ATTAAAAAACAAAACAAGGCTGG + Intronic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1040606889 8:48942917-48942939 ATGGAAAGAAAAAAAAAGGAGGG - Intergenic
1041083473 8:54235298-54235320 AAGGAGAAATTGAACAAGGAGGG + Intergenic
1041378174 8:57223437-57223459 ATGGGAAAACTCAACAATGAGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041982104 8:63873767-63873789 ATGGACGAACAGAAGAAAGAAGG + Intergenic
1042170077 8:65982683-65982705 AAGGAAAAAGAAAAGAAGGAAGG + Intergenic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1042648318 8:71011990-71012012 ATGTAAAAAGAGAACATGGTAGG - Intergenic
1043372493 8:79611324-79611346 ATGGTAACACAGGACCAGGAAGG + Intronic
1043509665 8:80937248-80937270 ATGGAAAAAAAAAAAAAGAAAGG + Intergenic
1043825658 8:84925674-84925696 AGGGAAAAACAAAGCAGGGAAGG + Intergenic
1044111388 8:88279703-88279725 ATGGAAAAACAAAATATGGAGGG + Intronic
1044172314 8:89070265-89070287 ATGGTAAAAAAGGACAAAGAAGG - Intergenic
1044221430 8:89674438-89674460 AATGAAAAACAAAACAAGGCAGG + Intergenic
1044326411 8:90864274-90864296 GTGGAAAAAAAAAACGAGGAAGG + Intronic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1044799880 8:95943163-95943185 ATGGAGAAACACAGCAAGAAGGG - Intergenic
1044822431 8:96163401-96163423 ATGGAAATAGATCACAAGGAGGG - Intergenic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1045205225 8:100032335-100032357 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1045373615 8:101549732-101549754 AGGGCAGGACAGAACAAGGAAGG - Intronic
1045696369 8:104813070-104813092 ATGGAAATACAGCACATTGAAGG - Intronic
1045850606 8:106693335-106693357 AGGGAAAAACAAAACAGGAAGGG + Intronic
1045906282 8:107348924-107348946 ATGGAAAGACATCACAAGCAAGG + Intronic
1045918695 8:107504129-107504151 AGGGAAAAAGAGAAGAAAGAAGG - Intergenic
1046036509 8:108848426-108848448 AAGGAAAAAAGGAACAGGGAAGG + Intergenic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046405378 8:113765866-113765888 ATAGAAAAACAGCAAAAGTAAGG + Intergenic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1046486640 8:114896031-114896053 ATGCAATAACAAAGCAAGGAAGG - Intergenic
1046588398 8:116175968-116175990 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
1046588427 8:116176161-116176183 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
1046667937 8:117025616-117025638 ATGGAAAAAGAGAATATGAATGG - Intronic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1047457338 8:125027762-125027784 ATGGAAAAATAGAATAAAAAAGG + Intronic
1047796281 8:128259128-128259150 AGAGAAAAATAGAACAAGCATGG - Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048115683 8:131519346-131519368 ATGACACAACAGAAAAAGGAGGG - Intergenic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1048915498 8:139178927-139178949 AGGGAGAAACAGAACAGGGCAGG + Intergenic
1049440089 8:142605534-142605556 ATGGAAGAACACAGCAAGCAGGG - Intergenic
1049793391 8:144483864-144483886 AAGGAAAAAGAAAACAGGGAAGG - Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1050094173 9:2047078-2047100 AAGGAAAAAAAAAAAAAGGAGGG - Intronic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050289133 9:4135791-4135813 ATGCAAAAACAGATCGATGAAGG + Intronic
1050958555 9:11696082-11696104 ATGGAACAAAAGAAGAAAGAAGG - Intergenic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1050994071 9:12191440-12191462 ATGTAAAAAAAAAAAAAGGAAGG - Intergenic
1051049968 9:12920618-12920640 ATGGAAAAACTGACCAACTATGG - Intergenic
1051524450 9:18027968-18027990 ATAGTAAAAAAGAACAAAGAAGG - Intergenic
1052349129 9:27440375-27440397 ATGGAAAAAAAAAAAAAAGAAGG - Intronic
1052511025 9:29420753-29420775 ATGGAAAAATAAAGCAGGGAAGG - Intergenic
1052638064 9:31128394-31128416 ATGGAAACACATAAATAGGAAGG + Intergenic
1052950287 9:34203787-34203809 AAGGAAAAACAATATAAGGATGG - Intronic
1054887050 9:70210456-70210478 ATGGAAAACAAGAAAAAGGCAGG - Intronic
1055037674 9:71835830-71835852 AAGGAAGAAAAGAAGAAGGAAGG - Intergenic
1055274091 9:74594790-74594812 AAAGAAAAAGAGAAAAAGGAAGG + Intronic
1055707409 9:79020837-79020859 AAGCAAAAACAGAACAAAAATGG + Intergenic
1055737741 9:79350390-79350412 ATGGAAAAGCATTACAATGAAGG - Intergenic
1055868548 9:80845622-80845644 AAAGAAAAAGAGAAGAAGGAAGG - Intergenic
1056086491 9:83154720-83154742 ATGCAAAGACAGAAAAAGGCAGG - Intergenic
1056124751 9:83524229-83524251 TTGTAAAAAGAGAAAAAGGAAGG - Intronic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057633950 9:96745654-96745676 ATGGAAAAAGAGACAAATGAAGG - Intergenic
1057980154 9:99652440-99652462 AATGGAAAACAGAAAAAGGAGGG + Intergenic
1058626354 9:106937222-106937244 ATGAAAAAATAGAATAAAGAGGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058774734 9:108272415-108272437 AAGGAAAAATAAGACAAGGAGGG + Intergenic
1058890452 9:109356405-109356427 ATGCAAAAACAGAACTGTGAGGG - Intergenic
1059036686 9:110761504-110761526 TTGGAAAAAAAGAAAAAAGAAGG - Intronic
1059267139 9:113045423-113045445 ATTGGAAAACAAAACAAGGTTGG - Intronic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059882518 9:118707266-118707288 AAGGAAGAAAAGAAAAAGGAAGG + Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060517027 9:124272266-124272288 ATGAACAAAGAAAACAAGGAAGG - Intronic
1060630074 9:125149103-125149125 ATTTAAAAACACAACAAGGAGGG + Exonic
1061470852 9:130824344-130824366 ACAAAAAAACAGAAAAAGGAAGG - Intronic
1061805622 9:133136222-133136244 AGGCAAAAACAGAACAGGGAAGG + Intronic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186162445 X:6792150-6792172 ATAGAACAAAATAACAAGGAGGG + Intergenic
1186166066 X:6827284-6827306 ATGCAAAAACAAAGCAAGGAAGG + Intergenic
1186330978 X:8534030-8534052 ATGGAGAAAGGAAACAAGGAAGG + Intronic
1186365658 X:8890646-8890668 ATGGAAATTCATACCAAGGAAGG - Intergenic
1186448615 X:9653519-9653541 GTGGAAAACCAGAACACAGAAGG - Intronic
1186547545 X:10466346-10466368 AAGGAAAAACACAACAAAAAGGG - Intronic
1186571290 X:10717363-10717385 ATGGAAAAAAAAAAAAAGGCAGG + Intronic
1186741668 X:12524543-12524565 AAGGAAGAAGAGAACAAGTAAGG + Intronic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187008503 X:15255534-15255556 ATGGAAAAATAGCACAATGCTGG - Intronic
1187199618 X:17122191-17122213 ACTGGAAAACAGCACAAGGAGGG - Intronic
1187553675 X:20331035-20331057 CTGGAAATATAGAACAAGGTAGG - Intergenic
1187574559 X:20540742-20540764 ATGGAAATAGAGTAAAAGGATGG - Intergenic
1187575957 X:20555547-20555569 TTGGAAAAGAAGAACAAAGAGGG + Intergenic
1187670329 X:21659684-21659706 AGGGAAAAACAGTTCAAGGAAGG + Intergenic
1187996950 X:24936825-24936847 ATGGAATAACACAACCAGGCCGG - Intronic
1188204837 X:27343236-27343258 GAAGAAAAACAGCACAAGGAGGG + Intergenic
1188648563 X:32600365-32600387 ATAGAAAACAAAAACAAGGATGG + Intronic
1188680825 X:33002282-33002304 ATGCACAAACAAAGCAAGGAAGG + Intronic
1189159266 X:38793914-38793936 AAGGAAAGACAGACAAAGGAAGG + Intergenic
1189626749 X:42905562-42905584 ATGGCAAAAAAGGACAAAGAAGG + Intergenic
1189712798 X:43831568-43831590 AAGGAAACAAAAAACAAGGAAGG + Intronic
1189719698 X:43903705-43903727 AGGAAAAACAAGAACAAGGAGGG + Intergenic
1189867292 X:45344238-45344260 ATGCACAAACAAAGCAAGGAAGG - Intergenic
1190679934 X:52817564-52817586 ATGTTAAAAAAGAACAAAGAAGG + Intronic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1190921517 X:54857760-54857782 ATGGAAAACAAGAAAAAGGCAGG - Intergenic
1191155567 X:57269051-57269073 AATGAAAAACAGAAAAAGAAGGG + Intergenic
1192780943 X:74293313-74293335 GGGGAAGAACAGAACATGGAGGG - Intergenic
1193074051 X:77336276-77336298 ATGGAAAGAAAGAAAAAGCAGGG + Intergenic
1193507775 X:82364160-82364182 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1193650848 X:84129806-84129828 ATGGAAATAGAGTAGAAGGATGG + Intronic
1193913324 X:87332355-87332377 TTTGAAAAACACAACAAAGATGG - Intergenic
1194203776 X:90985827-90985849 AAGGAAAAAAAAAAAAAGGAGGG + Intergenic
1194608228 X:96007403-96007425 ATGGAAAAACAGAAAAAAGTAGG + Intergenic
1194615703 X:96100873-96100895 ATGAAAAAATAGAAAAAGAAGGG - Intergenic
1194943361 X:100039750-100039772 ATAGACAAACAGAACAAGTAAGG + Intergenic
1194946278 X:100072251-100072273 ATTGAACATAAGAACAAGGATGG - Intergenic
1195602448 X:106764259-106764281 GTTGAAAAACAAAACAAGGCCGG - Intronic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196087857 X:111705885-111705907 AGGGAAAATCAGGAGAAGGAGGG - Intronic
1196967774 X:121077109-121077131 ATGCACAAACAAAACAAGGAAGG + Intergenic
1197129281 X:122985901-122985923 ATGGAAAAACAAAGCTCGGATGG - Intergenic
1197190446 X:123641651-123641673 AATGAAAAACAGAGAAAGGAGGG - Intronic
1197243628 X:124146151-124146173 ATGCACAAACAGAGCAAGGAAGG + Intronic
1197269029 X:124405837-124405859 AAGGAAGAACAGAAGAAGAAAGG - Intronic
1197395834 X:125925864-125925886 ATGGAAAAATAGAAAAAAGAAGG - Intergenic
1197621510 X:128755626-128755648 ATGTAATAAGAGAACAAGAATGG + Intergenic
1197672201 X:129290251-129290273 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1197866439 X:131023912-131023934 ATGGAAAGACTGTACAAGAATGG - Intergenic
1198112773 X:133516255-133516277 ATGGGAAAGCAGAACACAGAGGG - Intergenic
1198308823 X:135409270-135409292 ATAGCATAACATAACAAGGAGGG + Intergenic
1198696128 X:139340517-139340539 ATGGCAAAACAGAAAAAGTAGGG + Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1198975938 X:142335620-142335642 ATGGAAAAAAGGCACAAGGAAGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199410803 X:147519916-147519938 ATGGGAAAACAGAAAAAAGCAGG + Intergenic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1199914739 X:152327022-152327044 ATGGAAAAAAAAAAAAAGCAGGG + Intronic
1200130593 X:153842161-153842183 AGGCAAAAACAGAACAAGATAGG - Intergenic
1200663843 Y:5995778-5995800 ATGCCACAACAGAACAGGGAGGG - Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200734088 Y:6775203-6775225 ATGCACAAACAAAGCAAGGAAGG + Intergenic
1200762639 Y:7054182-7054204 ATGCACAAACAAAGCAAGGAAGG + Intronic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201372676 Y:13282526-13282548 AGAGAGAAACAGAACAAGGCAGG - Intronic
1201373357 Y:13289470-13289492 AGAGAGAAACAGAACAAGGCAGG - Intronic