ID: 908479905

View in Genome Browser
Species Human (GRCh38)
Location 1:64528870-64528892
Sequence ATGGTAGTCCCCCAATTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908479901_908479905 3 Left 908479901 1:64528844-64528866 CCATTTAAAAAATATCCTAATAC No data
Right 908479905 1:64528870-64528892 ATGGTAGTCCCCCAATTTAATGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908479905 Original CRISPR ATGGTAGTCCCCCAATTTAA TGG Intronic
903658469 1:24963106-24963128 ATGGGAGTGCCCCCATTTCAGGG + Intronic
907820757 1:57965846-57965868 ATGGAAGTCTTCCACTTTAATGG - Intronic
908479905 1:64528870-64528892 ATGGTAGTCCCCCAATTTAATGG + Intronic
911420516 1:97635262-97635284 ATGGAATTCCCACAATTAAATGG - Intronic
918759095 1:188378244-188378266 ATTGTAGTCCCCAAATATCACGG - Intergenic
924192424 1:241567607-241567629 ATGGTAGATACCCATTTTAAAGG - Intronic
1064504647 10:16015425-16015447 ATGGTAGTCCCCCACCCTCAAGG - Intergenic
1065399763 10:25285649-25285671 ATGGTACTCACCCACTTTGAGGG + Intronic
1068107913 10:52643031-52643053 ATGAGAGTCCTCAAATTTAAAGG + Intergenic
1069866731 10:71508453-71508475 ATGCAATTCCCCCCATTTAACGG - Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1070848667 10:79544873-79544895 ATGGAAATCCCCCAAATTTAGGG - Intergenic
1074302708 10:112247486-112247508 ATTGCAGTGTCCCAATTTAAGGG + Intergenic
1080759415 11:35233712-35233734 ATGGTAGTTCCCCAAGGAAATGG + Intergenic
1086207466 11:84276746-84276768 ATGGTAGTCCCACCATACAAAGG - Intronic
1092494929 12:8984008-8984030 ACTGTAGTCCCCCAAAATAAAGG - Intronic
1093335072 12:17895064-17895086 ATGGTAGTCACCAAATTTCTGGG - Intergenic
1095731069 12:45507322-45507344 ATGTAAGACCCCAAATTTAAAGG + Intergenic
1095844917 12:46734095-46734117 ATGGTACCCACCCAAGTTAAGGG + Intergenic
1097594565 12:61612485-61612507 ATGGTAGTCCCCCTTATTCATGG - Intergenic
1098659187 12:73071695-73071717 ATGGTGGTCACCCAGATTAAGGG - Intergenic
1109365748 13:61354471-61354493 ATTGTAATCCCCACATTTAAAGG + Intergenic
1114903621 14:27098029-27098051 AGGGTAGTCACCCTATTTGAGGG + Intergenic
1115059346 14:29170939-29170961 ATGGTGCTCACCCAAATTAAGGG - Intergenic
1122665762 14:103328413-103328435 ATGGGCGTCCCCCAGTTTTAAGG + Intergenic
1139578688 16:67858792-67858814 CTGGAAGTCCCCCGATTTTATGG - Intronic
1140966330 16:79969650-79969672 ATATTAGTCTCCCATTTTAAAGG - Intergenic
1141237067 16:82228595-82228617 ATAGTGCTTCCCCAATTTAATGG + Intergenic
1145870450 17:28269174-28269196 ATGGTAAGCCCCCGATCTAAAGG + Intergenic
1153076529 18:1167727-1167749 AGGGTAGTCTCCCTATTTTAAGG - Intergenic
1164227538 19:23258925-23258947 GTGGTAGTCTCCCATTTTATAGG + Intergenic
1164932784 19:32188092-32188114 ATGGTAGGGCCCCTTTTTAAGGG - Intergenic
926037110 2:9644433-9644455 ATGGTAGTTCCCCAACTTGAAGG + Intergenic
927313273 2:21653825-21653847 ATGGTAGTTTGCCAATCTAAGGG + Intergenic
929679018 2:43969613-43969635 AGGGTAGTCACTAAATTTAAAGG + Intronic
932429194 2:71663848-71663870 ATTGGAGTCCCCCAATTTACCGG + Intronic
947196490 2:227573348-227573370 CTGGTAATCCTCCAATTCAATGG - Intergenic
947567816 2:231205983-231206005 AGGATCATCCCCCAATTTAAAGG + Intronic
1175650407 20:60716636-60716658 ATGTTATTCCCACAGTTTAAGGG - Intergenic
1178503110 21:33141899-33141921 ATTGCATTCCCCCAAATTAAAGG - Intergenic
951445668 3:22777090-22777112 CTCATAATCCCCCAATTTAAGGG - Intergenic
956680418 3:71774370-71774392 ATGGTAGTCCAACAATGTAAAGG + Intronic
957445995 3:80313646-80313668 GTGGAAGTCCCCCAATTAAAAGG + Intergenic
958180027 3:90048275-90048297 ATTTTAGTTTCCCAATTTAATGG + Intergenic
959568744 3:107859449-107859471 ATGGTGCTCACCCAGTTTAAGGG - Intergenic
960901973 3:122562828-122562850 CTGCTAGTCCCCCTATTTATGGG + Intronic
967998161 3:195182188-195182210 ATGGTAGTTTCCCATCTTAAAGG - Intronic
977339145 4:95735456-95735478 AAGGTAGTCCCTCACTGTAAAGG + Intergenic
978159521 4:105529179-105529201 ATGCTAGGCCCCAAACTTAAAGG - Intergenic
979040706 4:115789381-115789403 ATGGTACCCACCCAAATTAAGGG + Intergenic
983838769 4:172428407-172428429 ATTTTAATCTCCCAATTTAAAGG - Intronic
990703568 5:58501490-58501512 ATGGTAGTCTCCCTTATTAATGG + Intergenic
991241084 5:64460692-64460714 ATTATATTCCCCCAATTAAAAGG + Intergenic
1005464061 6:26094564-26094586 ATGTAAGTCCCCCAAATTTAAGG - Exonic
1009467371 6:63988541-63988563 ATGGAAGTCGACCATTTTAATGG - Intronic
1009503106 6:64442484-64442506 ATGTTAATCCCCCAAGATAATGG + Intronic
1010374436 6:75150244-75150266 ATGGTAATCACCAAATTTGAAGG - Intronic
1012071244 6:94619585-94619607 ATGGTAGGCCTACATTTTAAAGG + Intergenic
1022688436 7:32619473-32619495 ATTGTAGACCACCCATTTAATGG + Intergenic
1024268990 7:47628256-47628278 ATGGTGGTCCCATAATATAATGG + Intergenic
1027536628 7:79411305-79411327 AGGGTAATCTCCCTATTTAAAGG - Intronic
1028217633 7:88154089-88154111 ATGGCAGTCCTCCCATTTTATGG + Intronic
1030125157 7:106146263-106146285 ATTGCAGTCCCCTCATTTAATGG + Intergenic
1031779507 7:125943359-125943381 ATGGTATTCACCCAGATTAAGGG - Intergenic
1031939026 7:127767469-127767491 ATGGTAGACTTCCAATTAAAAGG + Intronic
1039415979 8:37394280-37394302 AAGGAAGTTCCCCAAATTAAGGG + Intergenic
1040057752 8:43075327-43075349 ATGATAGTCCCCGATTTTACAGG - Intronic
1043766090 8:84134121-84134143 ATGGAAGTCACCCAAGGTAATGG + Intergenic
1055354046 9:75418979-75419001 AGCATAGTCACCCAATTTAAAGG + Intergenic
1188212654 X:27443280-27443302 AGGCTAGTACCCCAATTCAAAGG - Intergenic
1192628621 X:72756782-72756804 AGGGTAGGGCCCTAATTTAATGG + Intergenic
1192653087 X:72964032-72964054 AGGGTAGGGCCCTAATTTAATGG - Intergenic
1196247042 X:113412569-113412591 AAGGTACCCCACCAATTTAATGG - Intergenic
1196311348 X:114170166-114170188 ATGATACTCCCCCAATTTTGTGG - Intergenic
1197097038 X:122609191-122609213 ATGGTATCCCCCCAGATTAAGGG - Intergenic