ID: 908483569

View in Genome Browser
Species Human (GRCh38)
Location 1:64568424-64568446
Sequence CTCTCTTCCCATATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908483562_908483569 23 Left 908483562 1:64568378-64568400 CCTGGAGGATATAGCAACCCTTA 0: 1
1: 0
2: 0
3: 9
4: 154
Right 908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG No data
908483566_908483569 -4 Left 908483566 1:64568405-64568427 CCTCTCAGAACTCCCGGATCTCT 0: 1
1: 0
2: 0
3: 11
4: 170
Right 908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG No data
908483563_908483569 6 Left 908483563 1:64568395-64568417 CCCTTAGATACCTCTCAGAACTC No data
Right 908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG No data
908483561_908483569 24 Left 908483561 1:64568377-64568399 CCCTGGAGGATATAGCAACCCTT No data
Right 908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG No data
908483564_908483569 5 Left 908483564 1:64568396-64568418 CCTTAGATACCTCTCAGAACTCC 0: 1
1: 0
2: 4
3: 7
4: 128
Right 908483569 1:64568424-64568446 CTCTCTTCCCATATGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908483569 Original CRISPR CTCTCTTCCCATATGAAGCC TGG Intronic
No off target data available for this crispr