ID: 908486572

View in Genome Browser
Species Human (GRCh38)
Location 1:64600089-64600111
Sequence CTGTGAAATGGGTAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908486566_908486572 17 Left 908486566 1:64600049-64600071 CCCTGACTTGCTATGTGATCTTT No data
Right 908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG No data
908486567_908486572 16 Left 908486567 1:64600050-64600072 CCTGACTTGCTATGTGATCTTTG 0: 1
1: 0
2: 5
3: 55
4: 406
Right 908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908486572 Original CRISPR CTGTGAAATGGGTAGGAGAA AGG Intronic
No off target data available for this crispr