ID: 908486572 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:64600089-64600111 |
Sequence | CTGTGAAATGGGTAGGAGAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908486566_908486572 | 17 | Left | 908486566 | 1:64600049-64600071 | CCCTGACTTGCTATGTGATCTTT | No data | ||
Right | 908486572 | 1:64600089-64600111 | CTGTGAAATGGGTAGGAGAAAGG | No data | ||||
908486567_908486572 | 16 | Left | 908486567 | 1:64600050-64600072 | CCTGACTTGCTATGTGATCTTTG | 0: 1 1: 0 2: 5 3: 55 4: 406 |
||
Right | 908486572 | 1:64600089-64600111 | CTGTGAAATGGGTAGGAGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908486572 | Original CRISPR | CTGTGAAATGGGTAGGAGAA AGG | Intronic | ||
No off target data available for this crispr |