ID: 908489351

View in Genome Browser
Species Human (GRCh38)
Location 1:64627497-64627519
Sequence GATGGTCTACTCTGTCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489351_908489355 12 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489355 1:64627532-64627554 TGGAGTTCATGATGCTCTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 156
908489351_908489358 24 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489358 1:64627544-64627566 TGCTCTAGAGGAGAAGAGGCGGG No data
908489351_908489352 -8 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489352 1:64627512-64627534 AGACCATCGTCTTACCTTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 67
908489351_908489357 23 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489351_908489356 20 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG 0: 1
1: 0
2: 3
3: 103
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489351 Original CRISPR GATGGTCTACTCTGTCTCCT TGG (reversed) Intronic