ID: 908489353

View in Genome Browser
Species Human (GRCh38)
Location 1:64627515-64627537
Sequence ACTCCAAGAAGGTAAGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489353_908489356 2 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG 0: 1
1: 0
2: 3
3: 103
4: 1158
908489353_908489357 5 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489353_908489355 -6 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489355 1:64627532-64627554 TGGAGTTCATGATGCTCTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 156
908489353_908489358 6 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489358 1:64627544-64627566 TGCTCTAGAGGAGAAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489353 Original CRISPR ACTCCAAGAAGGTAAGACGA TGG (reversed) Intronic