ID: 908489354

View in Genome Browser
Species Human (GRCh38)
Location 1:64627526-64627548
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489354_908489360 25 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489360 1:64627574-64627596 CTGTTGCACCTGAGTTCACAGGG 0: 1
1: 0
2: 0
3: 9
4: 233
908489354_908489359 24 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489359 1:64627573-64627595 ACTGTTGCACCTGAGTTCACAGG 0: 1
1: 0
2: 0
3: 11
4: 163
908489354_908489357 -6 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489357 1:64627543-64627565 ATGCTCTAGAGGAGAAGAGGCGG 0: 1
1: 1
2: 1
3: 27
4: 298
908489354_908489358 -5 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489358 1:64627544-64627566 TGCTCTAGAGGAGAAGAGGCGGG No data
908489354_908489356 -9 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG 0: 1
1: 0
2: 3
3: 103
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489354 Original CRISPR GAGCATCATGAACTCCAAGA AGG (reversed) Intronic