ID: 908489356

View in Genome Browser
Species Human (GRCh38)
Location 1:64627540-64627562
Sequence ATGATGCTCTAGAGGAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1265
Summary {0: 1, 1: 0, 2: 3, 3: 103, 4: 1158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908489351_908489356 20 Left 908489351 1:64627497-64627519 CCAAGGAGACAGAGTAGACCATC No data
Right 908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG 0: 1
1: 0
2: 3
3: 103
4: 1158
908489353_908489356 2 Left 908489353 1:64627515-64627537 CCATCGTCTTACCTTCTTGGAGT No data
Right 908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG 0: 1
1: 0
2: 3
3: 103
4: 1158
908489354_908489356 -9 Left 908489354 1:64627526-64627548 CCTTCTTGGAGTTCATGATGCTC No data
Right 908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG 0: 1
1: 0
2: 3
3: 103
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908489356 Original CRISPR ATGATGCTCTAGAGGAGAAG AGG Intronic
900039164 1:442327-442349 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
900060597 1:677303-677325 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
902141465 1:14360497-14360519 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
902965354 1:19996995-19997017 GTGATACTTTGGAGGAGAAGAGG - Intergenic
903159655 1:21477330-21477352 CTGATCCTTTGGAGGAGAAGGGG + Intronic
903951715 1:26999522-26999544 GTGATGCTCTAGAGAAGCAGAGG - Intronic
906557982 1:46729425-46729447 CTGATCCTTTGGAGGAGAAGAGG - Intergenic
906585848 1:46977059-46977081 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
906894258 1:49754126-49754148 GTGATCCTTTGGAGGAGAAGAGG + Intronic
906901016 1:49836632-49836654 ATGATCCTTTGGAGGAGAAGAGG + Intronic
907654519 1:56328752-56328774 AGGATGTTCAAGAAGAGAAGTGG - Intergenic
907735666 1:57109259-57109281 AACATGAACTAGAGGAGAAGAGG - Intronic
907953671 1:59207576-59207598 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
907978887 1:59461004-59461026 GTGATCCTTTGGAGGAGAAGAGG - Intronic
908194887 1:61738938-61738960 AAGATCCTCCAGAGGTGAAGTGG + Intergenic
908489356 1:64627540-64627562 ATGATGCTCTAGAGGAGAAGAGG + Intronic
908576618 1:65467085-65467107 ATGTTCCTTTGGAGGAGAAGAGG + Intronic
908592994 1:65653068-65653090 GTGGTCCTTTAGAGGAGAAGAGG - Intergenic
908910797 1:69071025-69071047 ATGATCATTTGGAGGAGAAGAGG + Intergenic
908937561 1:69394491-69394513 ACGATCCTTTGGAGGAGAAGAGG + Intergenic
909301246 1:74015453-74015475 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
909415790 1:75403783-75403805 GTGATCCTGTGGAGGAGAAGAGG - Intronic
909558473 1:76982097-76982119 GTGATCCTTTGGAGGAGAAGAGG - Intronic
909672514 1:78204481-78204503 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
910104825 1:83620527-83620549 ATGAGGGTGAAGAGGAGAAGAGG - Intergenic
910383696 1:86658530-86658552 GCGATCCTTTAGAGGAGAAGAGG - Intergenic
910572165 1:88717850-88717872 GCGATCCTTTAGAGGAGAAGAGG + Intronic
910601102 1:89033589-89033611 GTGATCCTCTGGAAGAGAAGAGG + Intergenic
910805611 1:91187693-91187715 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
911517090 1:98880653-98880675 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
911541230 1:99161288-99161310 ATGATCCTTTGGAGGAAAAGAGG + Intergenic
911632786 1:100200994-100201016 GTGATCCTTTGGAGGAGAAGAGG - Intronic
911669619 1:100592967-100592989 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
912133234 1:106627801-106627823 ATGATCCCATGGAGGAGAAGAGG + Intergenic
912301271 1:108519796-108519818 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
912646267 1:111394827-111394849 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
912676021 1:111681285-111681307 GTGATCCTTTGGAGGAGAAGAGG - Intronic
912966380 1:114240657-114240679 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
913036175 1:114968732-114968754 GTGATCCTTTGGAGGAGAAGAGG + Intronic
913342106 1:117769020-117769042 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
913410325 1:118543596-118543618 TTGATCCTTTGGAGGAGAAGAGG - Intergenic
913506944 1:119525931-119525953 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
913526248 1:119696437-119696459 ACGATCCTTTGGAGGAGAAGAGG + Intronic
914458173 1:147855931-147855953 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
915085778 1:153387843-153387865 TTCATGCTCAAGAGGAGAAGAGG - Intergenic
915605207 1:156946059-156946081 ATGATGCTCTCCAGCAGCAGCGG + Exonic
915649224 1:157295305-157295327 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
915651668 1:157316347-157316369 GTGATCCTTTGGAGGAGAAGCGG - Intergenic
915688568 1:157662711-157662733 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
915976031 1:160389949-160389971 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
916312749 1:163415114-163415136 TTGATGCTGTAGAAGAGAAAAGG - Intergenic
916359678 1:163953621-163953643 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
916406406 1:164501566-164501588 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
916614735 1:166428515-166428537 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
916625487 1:166551496-166551518 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
916878606 1:168997652-168997674 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
916916224 1:169408973-169408995 GTGATCCTTTGGAGGAGAAGAGG - Intronic
917009654 1:170457099-170457121 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
917078120 1:171227313-171227335 ATGAAGCCCTAGAGGAAGAGTGG - Intergenic
917248436 1:173030591-173030613 GTGATCCTTTAGAGGAGAAGAGG - Intergenic
917357881 1:174144952-174144974 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
917401249 1:174652356-174652378 GTGATCCTTTGGAGGAGAAGAGG + Intronic
917584853 1:176416248-176416270 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
918159397 1:181883302-181883324 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
918353646 1:183684223-183684245 GTGATCCTCTGGAGGAGAAGAGG + Intronic
918373284 1:183882715-183882737 ATGCTGCCCTAAAGGGGAAGTGG + Intronic
918612706 1:186511466-186511488 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
918631949 1:186729660-186729682 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
918684534 1:187397900-187397922 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
919146649 1:193644447-193644469 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
919461530 1:197883580-197883602 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
919602024 1:199633931-199633953 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
919913331 1:202125452-202125474 AAAATGGTATAGAGGAGAAGGGG + Intronic
920284530 1:204870275-204870297 CTGAGGCTCTCGAGCAGAAGTGG + Intronic
920347240 1:205314212-205314234 ATGAAGCTCTGGGGGAGGAGTGG - Intronic
920625137 1:207589546-207589568 GTGATCCTTTGGAGGAGAAGAGG - Intronic
920643276 1:207775432-207775454 GTGATCCTTTGGAGGAGAAGAGG + Intronic
920993488 1:210963372-210963394 GTGATCCTTTGGAGGAGAAGAGG - Intronic
921296722 1:213711566-213711588 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
921401257 1:214726735-214726757 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
921461422 1:215432208-215432230 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
921626311 1:217380749-217380771 GTGATCCTCTAAAGGAGAAGAGG - Intergenic
921631468 1:217438318-217438340 GTGATCCTTTAGAGGAGAAGAGG - Intronic
921712188 1:218384087-218384109 AAGATGTTCTAGAAGAGGAGAGG - Intronic
921962353 1:221048522-221048544 GTGATCCTTTAGAGGAAAAGAGG - Intergenic
922066332 1:222146858-222146880 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
922379898 1:225013018-225013040 GTGATTCTTTGGAGGAGAAGAGG + Intronic
922406112 1:225315495-225315517 GTGATCCTTTGGAGGAGAAGAGG + Intronic
922666658 1:227474976-227474998 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
922716130 1:227873249-227873271 ATGATTCTTTGGAGGAGAAGAGG - Intergenic
923061116 1:230475682-230475704 GTGATCCTCTGGAGGAGAAGAGG + Intergenic
923194364 1:231651120-231651142 GTGATCCTTTGGAGGAGAAGAGG + Intronic
923421854 1:233823367-233823389 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
923690778 1:236191397-236191419 GTGATCCTTTGGAGGAGAAGTGG + Intronic
924296150 1:242588034-242588056 ATGATCCTTTGTAGGAGAAGAGG - Intergenic
924631526 1:245745292-245745314 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
924822989 1:247512565-247512587 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1063178671 10:3575421-3575443 ATGATACTATAGAATAGAAGTGG - Intergenic
1065045034 10:21739353-21739375 ATGAAGATTTGGAGGAGAAGAGG - Intronic
1065119260 10:22513282-22513304 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1065735914 10:28752295-28752317 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1066042802 10:31567856-31567878 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1066159793 10:32715485-32715507 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1066706719 10:38187918-38187940 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1066751359 10:38660264-38660286 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1066965684 10:42262828-42262850 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
1067231014 10:44410763-44410785 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1067239870 10:44481394-44481416 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1067675532 10:48372308-48372330 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1068210204 10:53910598-53910620 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1068567728 10:58593809-58593831 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1068623130 10:59208510-59208532 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1068706258 10:60079228-60079250 ATTATGCTACAGAGCAGAAGAGG - Intronic
1068951700 10:62783394-62783416 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1069101141 10:64322361-64322383 ATGCTGAACTAGAGGAGAACAGG - Intergenic
1069300440 10:66900458-66900480 GTGATCCTCTGGGGGAGAAGAGG - Intronic
1069368753 10:67721714-67721736 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1070234335 10:74608287-74608309 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1070343545 10:75520737-75520759 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1070632620 10:78097459-78097481 CTGATCCTTTGGAGGAGAAGAGG - Intergenic
1070642772 10:78181247-78181269 ATGTTACTCTAGGGGAGCAGTGG - Intergenic
1070980363 10:80640846-80640868 GCGATCCTTTAGAGGAGAAGAGG + Intronic
1071066622 10:81643998-81644020 GCGATCCTTTAGAGGAGAAGAGG + Intergenic
1071341170 10:84650700-84650722 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1071698383 10:87902888-87902910 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1072358838 10:94639402-94639424 CTGATTCTTTGGAGGAGAAGAGG + Intergenic
1072365225 10:94702787-94702809 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1072834594 10:98697087-98697109 GTGATCATTTAGAGGAGAAGAGG - Intronic
1073129389 10:101177179-101177201 ATAATGGTCTAGAGGAGGATAGG - Intergenic
1073352767 10:102831609-102831631 ATGCTGCTCCAGAGTGGAAGAGG + Exonic
1074631358 10:115258671-115258693 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1074648394 10:115490784-115490806 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1075805260 10:125184015-125184037 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1075983788 10:126766097-126766119 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1076965381 11:78236-78258 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1077616952 11:3683016-3683038 ATGAGGCGCTAGAGGAGCAGGGG - Intronic
1078390978 11:10935160-10935182 AGGAGACTCTAGAGGAAAAGGGG + Intergenic
1078623381 11:12930505-12930527 TTGATTCTGTAGAAGAGAAGGGG + Intronic
1078809304 11:14742637-14742659 GTGATCCTTTAGAGGAGAAGAGG + Intronic
1078998468 11:16728666-16728688 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1079518051 11:21290927-21290949 GTGATGCTTTGGGGGAGAAGAGG - Intronic
1079580241 11:22055202-22055224 GTGATCATTTAGAGGAGAAGAGG + Intergenic
1079653900 11:22964962-22964984 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1079799669 11:24853677-24853699 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1079868026 11:25759384-25759406 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1079998624 11:27322225-27322247 GCGATCCTTTAGAGGAGAAGAGG - Intergenic
1080235748 11:30066676-30066698 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1080346752 11:31334436-31334458 GCGATGCTTTGGAGGAGAAGAGG + Intronic
1080710169 11:34738879-34738901 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1080744052 11:35091738-35091760 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1080912580 11:36618446-36618468 ATGATACTCTAGAGAAGACAGGG - Intronic
1081094844 11:38920391-38920413 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1081143724 11:39535837-39535859 ATGATCCTTTGGAGGAGAAGAGG + Intergenic
1081198924 11:40193540-40193562 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1081252225 11:40850188-40850210 GTGATCCTTTGGAGGAGAAGGGG + Intronic
1081363407 11:42206416-42206438 CTGATCCTTTGGAGGAGAAGAGG - Intergenic
1082182700 11:49139743-49139765 GTGATTCTTTGGAGGAGAAGAGG - Intergenic
1082945208 11:58750712-58750734 TTGATCCTTTGGAGGAGAAGAGG - Intergenic
1083385402 11:62305711-62305733 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1083898861 11:65634111-65634133 ATGATGCTCTGGGAGAGGAGGGG - Exonic
1085003502 11:73062373-73062395 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1085016063 11:73174767-73174789 ACCAAGGTCTAGAGGAGAAGGGG + Intergenic
1085433990 11:76482335-76482357 ATGATCCTTTGGAGGAGAAGAGG - Intronic
1085683671 11:78602497-78602519 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1086067751 11:82764604-82764626 ATGATCCTTTGAAGGAGAAGAGG + Intergenic
1086439503 11:86814277-86814299 ATGAGGCTTGAGAAGAGAAGAGG + Intronic
1086475624 11:87170340-87170362 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1086608569 11:88725972-88725994 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1086735534 11:90301698-90301720 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1086904719 11:92405264-92405286 ATGGTGCTCTAGAGGATCACAGG + Intronic
1086907014 11:92430388-92430410 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1087596245 11:100257875-100257897 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1087712349 11:101567953-101567975 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1087830858 11:102818946-102818968 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1088078184 11:105877965-105877987 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1088152039 11:106757406-106757428 TTGATCCTCTGGAGGAGAAAAGG + Intronic
1088211816 11:107465589-107465611 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1088380959 11:109192412-109192434 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1088788959 11:113207403-113207425 ATCATGGACTAGAGGAGAATGGG + Intronic
1089911807 11:122108380-122108402 ATGAGGCTCTAGACCAGTAGGGG + Intergenic
1089999632 11:122944448-122944470 AACATGTTCTAGAGGAGAATGGG - Intronic
1091417243 12:298634-298656 TTGATCCTCTGGAGGAGAAGAGG - Intronic
1091604840 12:1941555-1941577 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1092304490 12:7284641-7284663 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1092661831 12:10747282-10747304 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1092703376 12:11257435-11257457 ATGATCATTTGGAGGAGAAGAGG - Intergenic
1092916249 12:13192148-13192170 ATGTGGCTAGAGAGGAGAAGTGG - Intergenic
1093085829 12:14866389-14866411 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1093402421 12:18762002-18762024 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1093544926 12:20335665-20335687 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1093595358 12:20952195-20952217 GTGATTCTTTGGAGGAGAAGAGG - Intergenic
1093610656 12:21150781-21150803 ATGATCCTTTGGAGGAGATGAGG - Intronic
1093660079 12:21746563-21746585 ATGATCCTTTGGAGGAGAAGAGG + Intronic
1093694889 12:22147588-22147610 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1093714621 12:22367016-22367038 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1093900335 12:24624671-24624693 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1094073387 12:26445274-26445296 ATGAAGCTTTAGACGAGGAGCGG + Intronic
1094135304 12:27119334-27119356 ATGATCCTTTGGAGGAGAAGAGG + Intergenic
1094431931 12:30379578-30379600 GTGATCATTTAGAGGAGAAGAGG + Intergenic
1094757981 12:33493658-33493680 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1095128445 12:38509086-38509108 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1095406414 12:41871240-41871262 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1095488619 12:42709269-42709291 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1095547235 12:43387043-43387065 GTGATCCTCTGCAGGAGAAGAGG + Intronic
1095627583 12:44334725-44334747 ATGATGCTCTCCACGAGGAGTGG + Intronic
1095694985 12:45133558-45133580 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1095779005 12:46037938-46037960 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1095917947 12:47498648-47498670 GTGATCCTTTGGAGGAGAAGCGG - Intergenic
1096015999 12:48275492-48275514 ATGATCCTTTGGAGGAGAAGAGG + Intergenic
1096950201 12:55460379-55460401 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1097148627 12:56959324-56959346 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1097340045 12:58426951-58426973 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1097460598 12:59857215-59857237 GTGATTCTTTGGAGGAGAAGAGG - Intergenic
1097526741 12:60746525-60746547 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1097619625 12:61923673-61923695 ATGATCCTTTGGAGGAGAATAGG - Intronic
1097635079 12:62113038-62113060 ATGATCCTTTGAAGGAGAAGAGG + Intronic
1097643000 12:62204881-62204903 ATGATCATTTGGAGGAGAAGAGG + Intronic
1097701112 12:62820855-62820877 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1097710404 12:62911547-62911569 ATGAGGCTCAAGAGGAGCTGGGG - Intronic
1097737450 12:63197315-63197337 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1097775094 12:63635373-63635395 ATGCTCCTTTGGAGGAGAAGAGG - Intronic
1097948693 12:65402668-65402690 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1098151739 12:67554764-67554786 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1098287492 12:68922080-68922102 AAGATGCTCAAGAGGAGAAGAGG + Intronic
1098476542 12:70910723-70910745 CTGATGCTCTAGAGGTACAGAGG + Intronic
1098669825 12:73212604-73212626 ATGATGCTATAGAGAATATGAGG + Intergenic
1099010669 12:77287284-77287306 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1099071242 12:78048269-78048291 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1099512556 12:83555589-83555611 ATGATCCTTTGGAGGAGAAGAGG + Intergenic
1099522636 12:83682632-83682654 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1099540296 12:83899863-83899885 GTAATCCTTTAGAGGAGAAGAGG - Intergenic
1099797685 12:87420206-87420228 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1100740166 12:97582471-97582493 GTGATCCTTTAGAGGAGAAGAGG - Intergenic
1100768611 12:97897349-97897371 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1100798121 12:98203063-98203085 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1100896382 12:99186810-99186832 ATGATCCTTTGGAGAAGAAGAGG - Intronic
1100996153 12:100303303-100303325 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1101069730 12:101061936-101061958 ATGATCCTTTGGAGGAGAAGAGG + Intronic
1101206478 12:102493452-102493474 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1101361919 12:104035252-104035274 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1101472543 12:105012543-105012565 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1102323561 12:111958431-111958453 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1103073132 12:117961271-117961293 ATAATGCTGCAGAGGGGAAGGGG + Intronic
1104086388 12:125478201-125478223 ATGATCCTTTGGAGGAGAAGGGG - Intronic
1105501926 13:20980397-20980419 ATGAGGCTCTGAAGGAAAAGTGG - Intronic
1105629620 13:22149133-22149155 ATGATGCCCTGGTGGGGAAGGGG + Intergenic
1105737255 13:23284662-23284684 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1106025923 13:25954934-25954956 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1106042316 13:26104607-26104629 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1106326215 13:28693116-28693138 ATGATTCTTTGGAGGAGAAGAGG + Intergenic
1106334961 13:28775948-28775970 TTGATCCTTTGGAGGAGAAGAGG + Intergenic
1106335895 13:28783252-28783274 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1106361761 13:29038068-29038090 ATGATCCTTTGGAGGACAAGAGG + Intronic
1106377315 13:29202562-29202584 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1107289699 13:38839014-38839036 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1107648290 13:42517373-42517395 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1107673964 13:42776003-42776025 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1108029953 13:46219656-46219678 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1108205854 13:48089380-48089402 AAGATGATGTAAAGGAGAAGAGG - Intronic
1108217817 13:48201944-48201966 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1108471653 13:50773324-50773346 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1108549342 13:51527468-51527490 GTGATCCTCTGGAGGAGAAGAGG - Intergenic
1108673917 13:52720389-52720411 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1108773106 13:53729843-53729865 ATGTTTCTCAAGAGGACAAGGGG + Intergenic
1108797121 13:54044915-54044937 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1108998426 13:56764223-56764245 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1109033973 13:57231010-57231032 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1109216158 13:59591737-59591759 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1109385822 13:61628333-61628355 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1109436217 13:62306888-62306910 ATTATGCTTTAGTGCAGAAGTGG + Intergenic
1109457375 13:62610804-62610826 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1109615536 13:64829106-64829128 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1109891294 13:68617742-68617764 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1109902681 13:68794937-68794959 CTGATCCTTTGGAGGAGAAGAGG + Intergenic
1110067693 13:71129399-71129421 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1110631068 13:77708848-77708870 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1110824797 13:79959175-79959197 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1110942147 13:81363610-81363632 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1112152048 13:96774265-96774287 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1112860901 13:103829086-103829108 CTGATCCTTTGGAGGAGAAGAGG + Intergenic
1114240373 14:20861190-20861212 GTGCTCCTCTGGAGGAGAAGAGG - Intergenic
1114433923 14:22687074-22687096 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1114710190 14:24769537-24769559 GTGATCCTTTAGAAGAGAAGAGG - Intergenic
1114817796 14:25980251-25980273 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1115008061 14:28510824-28510846 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1115135111 14:30098497-30098519 ACGATCCTTTGGAGGAGAAGAGG - Intronic
1115162218 14:30409514-30409536 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1115276935 14:31620334-31620356 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1115511401 14:34140723-34140745 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1115690894 14:35843234-35843256 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1115749804 14:36477739-36477761 ATTATGCTCTGGAGGAGAGGAGG + Intronic
1115818554 14:37188866-37188888 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1115974282 14:38980244-38980266 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1116135689 14:40920701-40920723 ATGATGCTTAAAAGGTGAAGTGG + Intergenic
1116165467 14:41329423-41329445 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1116262298 14:42646009-42646031 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1116572317 14:46534129-46534151 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1116771341 14:49130827-49130849 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1117104395 14:52383237-52383259 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1117238090 14:53799258-53799280 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1117299125 14:54406896-54406918 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1117502240 14:56364627-56364649 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1117579511 14:57138011-57138033 ATGAAGCTCAAGAGGAGATGGGG - Intergenic
1117616956 14:57544139-57544161 CTGATCCTTTGGAGGAGAAGAGG + Intergenic
1117655589 14:57952372-57952394 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1117796937 14:59404771-59404793 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1117821980 14:59658818-59658840 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1117930419 14:60836291-60836313 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1118521287 14:66588324-66588346 GTGATACTTTGGAGGAGAAGAGG - Intronic
1119930469 14:78541671-78541693 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1120507594 14:85371990-85372012 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1120565214 14:86047390-86047412 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1120590690 14:86370286-86370308 AAGATGTTCTACAGGGGAAGGGG + Intergenic
1120773719 14:88410449-88410471 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1120843042 14:89103874-89103896 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1202842738 14_GL000009v2_random:138117-138139 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1202912137 14_GL000194v1_random:128359-128381 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1123429120 15:20199886-20199908 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1123480949 15:20630172-20630194 GTGATCCTTTAGAGGAGAAGAGG - Intergenic
1123576510 15:21675551-21675573 GTGATACTTTGGAGGAGAAGAGG + Intergenic
1123613134 15:22118019-22118041 GTGATACTTTGGAGGAGAAGAGG + Intergenic
1123637062 15:22370193-22370215 GTGATCCTTTAGAGGAGAAGAGG + Intergenic
1123884379 15:24709896-24709918 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1124084321 15:26532441-26532463 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1124419311 15:29505846-29505868 GTGATCCTTTGGAGGAGAAGGGG - Intronic
1124666844 15:31599575-31599597 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1125227290 15:37409232-37409254 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1125354426 15:38802523-38802545 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1126178146 15:45757857-45757879 GTGATCCTGTGGAGGAGAAGAGG + Intergenic
1126470642 15:49006850-49006872 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1126704960 15:51397951-51397973 ATGATGCTCAGGAGATGAAGGGG + Intronic
1126952078 15:53892927-53892949 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1127038361 15:54945157-54945179 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1127279681 15:57478261-57478283 AAGATGCTCTGTAGGAGAGGCGG + Intronic
1127373855 15:58363990-58364012 GTGATGCGTTGGAGGAGAAGAGG - Intronic
1127452450 15:59130591-59130613 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1129495459 15:75976392-75976414 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1129507829 15:76098156-76098178 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1129563336 15:76593910-76593932 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1129578594 15:76780971-76780993 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1131068265 15:89448124-89448146 ATGGGGCTATAGAGGAGAAATGG - Intergenic
1131363531 15:91817418-91817440 AGGATGCTCCAAGGGAGAAGTGG + Intergenic
1131794709 15:96003946-96003968 ACCATGCTCTAGAGGAGGTGAGG - Intergenic
1132442746 15:101885285-101885307 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1202985378 15_KI270727v1_random:409796-409818 GTGATACTTTGGAGGAGAAGAGG + Intergenic
1133579553 16:7129892-7129914 ATGACCCTCTAGATGATAAGTGG + Intronic
1133956861 16:10452175-10452197 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1134873954 16:17678572-17678594 GTGTTGTTCAAGAGGAGAAGAGG - Intergenic
1135807678 16:25557227-25557249 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1136855199 16:33649846-33649868 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1137239359 16:46641592-46641614 GTGATCCTCTGGAGAAGAAGAGG - Intergenic
1137296445 16:47098111-47098133 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1137336357 16:47553590-47553612 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1137356252 16:47767995-47768017 CTGATCCTTTGGAGGAGAAGAGG - Intergenic
1137412025 16:48236797-48236819 ATGCTGCTCTATAGAAGATGTGG - Intronic
1138055817 16:53832049-53832071 ATGATGGTCCAGATCAGAAGAGG + Intronic
1138260477 16:55616513-55616535 ATGATCCTTTGGAGGAGAAGGGG - Intergenic
1138782929 16:59810378-59810400 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1139298970 16:65927776-65927798 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1140813555 16:78600540-78600562 ATGATGATCCCTAGGAGAAGTGG - Intronic
1140830665 16:78747711-78747733 CTGACGCTCTAGGGAAGAAGAGG - Intronic
1140885785 16:79241126-79241148 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1141245994 16:82308467-82308489 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1203116781 16_KI270728v1_random:1498330-1498352 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1143427009 17:6848244-6848266 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1143550880 17:7629875-7629897 ATCAGGCCCTAGAGGAGGAGAGG + Intronic
1143639500 17:8188077-8188099 AAGATGCTCTAGAAGAGAAGGGG - Intergenic
1146237160 17:31177453-31177475 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1146766305 17:35524792-35524814 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1146825814 17:36022589-36022611 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1148514000 17:48198920-48198942 ATGATTCTAAAAAGGAGAAGAGG + Intronic
1148967515 17:51448072-51448094 GTGATCCTATGGAGGAGAAGAGG - Intergenic
1149223017 17:54436931-54436953 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1149352082 17:55800631-55800653 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1149541574 17:57471818-57471840 CTGATGCTCTGGGGCAGAAGTGG - Intronic
1150545909 17:66156467-66156489 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1151028674 17:70709464-70709486 AGGACGCTCTAGAAGAGAATGGG - Intergenic
1153059258 18:979152-979174 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1153313296 18:3699199-3699221 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1153436453 18:5072942-5072964 ATGATGCTCTGGAAGCCAAGAGG + Intergenic
1153441377 18:5123076-5123098 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1153796130 18:8623945-8623967 ATGAGGCTCTTGAGGGGAAGTGG - Intronic
1153798583 18:8647817-8647839 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1153976822 18:10275684-10275706 ATGATGCAATAGAGAAGAATGGG - Intergenic
1154101425 18:11478501-11478523 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1155101732 18:22617280-22617302 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1155114352 18:22749703-22749725 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1155665063 18:28298573-28298595 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1156166624 18:34429061-34429083 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1156415024 18:36879072-36879094 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1156979157 18:43264858-43264880 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1157066425 18:44356240-44356262 GTGATCCTTTAGAGGAGAAGAGG + Intergenic
1157279687 18:46338017-46338039 ATGATGCTGGTGAAGAGAAGGGG + Intronic
1158297559 18:56015609-56015631 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1158373292 18:56832922-56832944 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1158703805 18:59772396-59772418 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1159435759 18:68414812-68414834 ATGATGGTCTAAGGGAGAGGAGG + Intergenic
1159645674 18:70915809-70915831 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1159661113 18:71097179-71097201 GTGATCCTTTAGAGGAGAAGAGG + Intergenic
1159698195 18:71588679-71588701 AGGATGTCCTGGAGGAGAAGTGG + Intergenic
1159809265 18:72996791-72996813 ATGATGCTGGAGAGCAAAAGTGG - Intergenic
1159901897 18:74054345-74054367 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1159969684 18:74634102-74634124 ATGCAGCTCTAGAGAAGCAGAGG - Exonic
1160466534 18:79082460-79082482 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1160642185 19:147866-147888 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1164152258 19:22565413-22565435 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1164416735 19:28051787-28051809 ATGATACTTTGGAGGAGAAGAGG - Intergenic
1164516283 19:28938935-28938957 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1165254473 19:34567271-34567293 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1165970278 19:39623446-39623468 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1166163591 19:40970531-40970553 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1166263309 19:41658127-41658149 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1167417140 19:49380690-49380712 ATTATGTTATAGAGGAGGAGGGG + Intergenic
1167583315 19:50359102-50359124 ATGATGTACTGGGGGAGAAGAGG + Exonic
1168457825 19:56527410-56527432 GTGATCCTTTGGAGGAGAAGAGG - Exonic
1202656091 1_KI270708v1_random:23372-23394 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
925283443 2:2700952-2700974 AGTCTGCTCTAGAGGGGAAGGGG - Intergenic
925566263 2:5257743-5257765 GTGATTCTTCAGAGGAGAAGAGG + Intergenic
925728987 2:6903873-6903895 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
925750251 2:7083516-7083538 ATGATGCTCTAGAATAGAGTTGG + Intergenic
926313414 2:11691880-11691902 ATGATGCTCTAAAGGATAGTTGG - Intronic
926508710 2:13746244-13746266 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
926774788 2:16411237-16411259 ATGATGTTCTTGAGTAGATGGGG - Intergenic
928102306 2:28446143-28446165 ATGATGCTGAAGAGGTGATGTGG + Intergenic
928480928 2:31683074-31683096 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
928750780 2:34467593-34467615 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
929064630 2:37961746-37961768 GTGATCCTTTGGAGGAGAAGAGG + Intronic
929838141 2:45426934-45426956 GTGATCCTTTAGAGGAGAAGAGG - Intronic
930840094 2:55836577-55836599 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
930860230 2:56064606-56064628 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
931211973 2:60206384-60206406 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
931479014 2:62621441-62621463 GTGATTCTTTAGAGTAGAAGAGG + Intergenic
931814956 2:65891041-65891063 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
931986082 2:67744015-67744037 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
932051934 2:68406282-68406304 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
932511683 2:72299592-72299614 GTGATCCTTTGGAGGAGAAGAGG + Intronic
932540242 2:72643883-72643905 GTGATCCTTTGGAGGAGAAGAGG - Intronic
932646656 2:73510268-73510290 GTGATCCTTTGGAGGAGAAGAGG + Intronic
932868604 2:75373940-75373962 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
933166518 2:79082810-79082832 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
933880534 2:86664768-86664790 GTGATCCTTTGGAGGAGAAGAGG - Intronic
934314347 2:91902416-91902438 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
934551067 2:95261914-95261936 ATGTAGCTCTGAAGGAGAAGGGG - Intergenic
935010822 2:99134635-99134657 GTAATCCTTTAGAGGAGAAGAGG + Intronic
935430056 2:102966254-102966276 ATGAGGCTCTAGAGAAAAAGTGG - Intergenic
935604631 2:104958666-104958688 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
935982957 2:108644582-108644604 GTGATCCTTTGGAGGAGAAGAGG - Intronic
936640154 2:114303371-114303393 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
936649767 2:114413036-114413058 GTGATCCTTTAGAGGAGAAGAGG + Intergenic
936769413 2:115894150-115894172 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
936909980 2:117580321-117580343 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
937807412 2:126161860-126161882 GTGATGCTTTGGAGGAAAAGAGG - Intergenic
938168030 2:129049742-129049764 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
938221275 2:129569920-129569942 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
938874302 2:135517326-135517348 GTGATCCTTTGGAGGAGAAGAGG + Intronic
939180505 2:138797025-138797047 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
939687025 2:145212886-145212908 GTGATGCTTTGGAAGAGAAGAGG + Intergenic
939840717 2:147183483-147183505 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
939876572 2:147585514-147585536 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
939947042 2:148422519-148422541 GTGATCCTTTGGAGGAGAAGAGG - Intronic
939970905 2:148659272-148659294 ATGATTCTCTGGAAGGGAAGTGG - Intronic
939974887 2:148705935-148705957 GTGATCCTTTGGAGGAGAAGGGG - Intronic
940030429 2:149256696-149256718 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
940084150 2:149839170-149839192 GTGATCCTTTTGAGGAGAAGAGG + Intergenic
940096201 2:149978603-149978625 TTGATCCTTTGGAGGAGAAGAGG - Intergenic
940925291 2:159357060-159357082 GTGATCCTTTGGAGGAGAAGAGG - Intronic
940946643 2:159624766-159624788 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
940963879 2:159816285-159816307 ATAATTTTCTAGAGGAAAAGTGG + Intronic
941565246 2:167098598-167098620 GTGATCCTTTGGAGGAGAAGAGG + Intronic
941682204 2:168412098-168412120 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
941845424 2:170126990-170127012 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
942467397 2:176223309-176223331 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
942576865 2:177373252-177373274 GTGATCCTTTGGAGGAGAAGAGG + Intronic
942668986 2:178353180-178353202 GTGATCCTTTAGAGGAGAAGAGG - Intronic
942953564 2:181749592-181749614 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
943095006 2:183417705-183417727 ATGATCATTTGGAGGAGAAGAGG - Intergenic
943347874 2:186761859-186761881 GTGATGCTCAAGATGAAAAGAGG + Exonic
943552361 2:189356790-189356812 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
943599023 2:189892289-189892311 GTGATCCTTTGGAGGAGAAGAGG + Intronic
943660624 2:190555255-190555277 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
943836952 2:192525561-192525583 GTGATACTTTGGAGGAGAAGCGG - Intergenic
943987353 2:194639859-194639881 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
944275235 2:197830105-197830127 GTGATCCTTTGGAGGAGAAGGGG - Intronic
944347521 2:198685878-198685900 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
944371992 2:198995089-198995111 ATAATGCTCTAGGGAAGAAGTGG + Intergenic
944421696 2:199537436-199537458 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
944477142 2:200118573-200118595 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
945210760 2:207380242-207380264 GTGATCCTCTGGAGGAGAAGAGG + Intergenic
945486769 2:210406288-210406310 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
945533640 2:210986272-210986294 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
945716007 2:213358814-213358836 GTGATCCTTTGGAGGAGAAGAGG + Intronic
945776592 2:214113879-214113901 GTGATCCTTTGGAGGAGAAGAGG + Intronic
945945336 2:215989480-215989502 GTGATCCTTTGGAGGAGAAGAGG - Intronic
946790101 2:223292685-223292707 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
946913117 2:224486198-224486220 CTGATCCTTTGGAGGAGAAGAGG - Intronic
947086161 2:226455007-226455029 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
947364802 2:229382351-229382373 GTGATCCTTTGGAGGAGAAGAGG - Intronic
947492240 2:230604730-230604752 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
948223851 2:236293592-236293614 AGGATGCTGTAGAGGGGGAGTGG + Intergenic
1169012930 20:2265541-2265563 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1169030689 20:2404598-2404620 ATGATGCTAGAGAGCAGAAAAGG - Intronic
1169049282 20:2562354-2562376 GAGCTGCTCTTGAGGAGAAGGGG - Intronic
1169176766 20:3522999-3523021 GTGATCCTCTGGAGAAGAAGAGG - Intronic
1169319922 20:4624375-4624397 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1169396928 20:5240799-5240821 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1169605995 20:7319716-7319738 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1170134043 20:13053474-13053496 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1170294361 20:14807526-14807548 CTGATCCTTTGGAGGAGAAGAGG - Intronic
1170720326 20:18872457-18872479 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1170727208 20:18940905-18940927 ATGATTTTTTGGAGGAGAAGAGG + Intergenic
1171050586 20:21854495-21854517 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1171194195 20:23184946-23184968 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1171513277 20:25705756-25705778 GTGATGCTTTGGAGGAAAAGAGG + Intergenic
1172467007 20:35162651-35162673 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1173001332 20:39108040-39108062 ATGATGCGCAAGAGCAGATGAGG + Intergenic
1173515528 20:43663063-43663085 AGGATGCTCTGGAGGTGGAGGGG + Intergenic
1173576680 20:44116452-44116474 ATGAGGCTCGAGAGGTGAAGTGG - Intronic
1175724635 20:61309482-61309504 ATGAACATCTAGAGGAGGAGGGG - Intronic
1176631493 21:9143036-9143058 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1176641809 21:9311821-9311843 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
1177042571 21:16132254-16132276 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1177050401 21:16225691-16225713 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1177092104 21:16782001-16782023 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1177111590 21:17035201-17035223 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1177129792 21:17241565-17241587 GTGATGCTTTGGAGGAAAAGAGG - Intergenic
1177136495 21:17309705-17309727 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1177184061 21:17774801-17774823 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1177541113 21:22494577-22494599 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1177694693 21:24555907-24555929 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1178698810 21:34816628-34816650 AAGATGTTCTGGAGGAGATGGGG + Intronic
1178864317 21:36315724-36315746 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1179435953 21:41362262-41362284 AAGAGGCTCTGGAGGGGAAGTGG + Intronic
1179582471 21:42352233-42352255 ATGAGGGTCTGGAGGAGCAGGGG - Intergenic
1180350824 22:11801173-11801195 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
1180375101 22:12084571-12084593 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
1180387384 22:12190897-12190919 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1180541110 22:16448299-16448321 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1180596353 22:16976107-16976129 GTGATCCTCTGGAGGAGAAGAGG - Intronic
1180641169 22:17300591-17300613 ATGAAGCTATAGAGTACAAGGGG - Intergenic
1182204609 22:28610656-28610678 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1183021368 22:35030002-35030024 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
949222586 3:1653634-1653656 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
949532190 3:4966839-4966861 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
949683280 3:6540544-6540566 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
949846220 3:8372970-8372992 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
949955177 3:9261284-9261306 TTGATCCTTTGGAGGAGAAGAGG - Intronic
950136969 3:10588326-10588348 TTGCTGGTCTAGAGGAGGAGAGG + Intronic
950561861 3:13735455-13735477 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
950992154 3:17450319-17450341 GTGATCCTTTGGAGGAGAAGAGG - Intronic
951254371 3:20432174-20432196 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
951311023 3:21125950-21125972 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
951347098 3:21560214-21560236 GTGATCCTTTGGAGGAGAAGAGG + Intronic
951368400 3:21813285-21813307 GTGTTCCTTTAGAGGAGAAGAGG - Intronic
951429690 3:22592009-22592031 ATGATTTGCAAGAGGAGAAGGGG - Intergenic
951434133 3:22642659-22642681 GTGATCCCCTGGAGGAGAAGAGG + Intergenic
951439661 3:22707998-22708020 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
951503539 3:23417106-23417128 GTGATCTTTTAGAGGAGAAGAGG + Intronic
951676315 3:25246376-25246398 GTGATCCTTTGGAGGAGAAGAGG + Intronic
951777131 3:26323124-26323146 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
951789571 3:26465092-26465114 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
951795367 3:26533049-26533071 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
951826791 3:26876933-26876955 ATGATCCTTTGGAAGAGAAGAGG - Intergenic
951926816 3:27916542-27916564 TTGATGCTAAAGAGGAGAATGGG + Intergenic
952018482 3:28988347-28988369 TTGAAGCTCTAGATGAAAAGAGG - Intergenic
952587034 3:34905194-34905216 ATGTTCCTTTGGAGGAGAAGAGG - Intergenic
952842473 3:37659736-37659758 GTGATCCTTTGGAGGAGAAGAGG + Intronic
953047355 3:39305614-39305636 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
953074180 3:39552285-39552307 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
953081188 3:39620039-39620061 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
953092476 3:39743022-39743044 GTGATCCTTTAGAGGAGAAGAGG + Intergenic
953201848 3:40784805-40784827 AAGAAGCTCTTCAGGAGAAGGGG - Intergenic
953218951 3:40950323-40950345 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
953315988 3:41926433-41926455 GTGATCCTTTGGAGGAGAAGAGG - Intronic
953598436 3:44338873-44338895 ATGCTCCTCTAGGGGGGAAGCGG + Intronic
953895040 3:46791032-46791054 GTGATACTTTGGAGGAGAAGAGG - Intronic
954304710 3:49719527-49719549 ATGTCGCACTAGAGCAGAAGAGG - Exonic
954453520 3:50584624-50584646 TTGAGGCCCCAGAGGAGAAGAGG - Exonic
954490492 3:50900530-50900552 GTGATCCTTTGGAGGAGAAGAGG + Intronic
954510382 3:51120019-51120041 GTGATCCTTTGGAGGAGAAGAGG + Intronic
954525078 3:51262503-51262525 GTGATCCTCTGGAGGAGAAGAGG - Intronic
954531204 3:51321413-51321435 GTGATCCTCTGGAGGAGAAGAGG - Intronic
954572036 3:51648887-51648909 GTGATCCTTTGGAGGAGAAGAGG - Intronic
954950659 3:54469514-54469536 GTGATCCTTTGGAGGAGAAGAGG - Intronic
954978562 3:54722465-54722487 GTGATCCTTTGGAGGAGAAGAGG + Intronic
955172516 3:56581464-56581486 ATGTTCCTTTGGAGGAGAAGAGG + Intronic
955174980 3:56605326-56605348 GTGATCCTTTGGAGGAGAAGAGG + Intronic
955414167 3:58677654-58677676 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
955447930 3:59033283-59033305 GTGATTCTTTGGAGGAGAAGAGG - Intronic
955796627 3:62644201-62644223 ATAATGCTCTGGGGGAGGAGAGG + Intronic
956005937 3:64777876-64777898 GTGATACTTTGGAGGAGAAGAGG - Intergenic
956301782 3:67780653-67780675 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
956373148 3:68586192-68586214 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
957011147 3:75007940-75007962 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
957098323 3:75798834-75798856 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
957249784 3:77757836-77757858 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
957306707 3:78467094-78467116 ATGATCCTTTGGAGGAGAAGGGG + Intergenic
957474959 3:80710512-80710534 GTGATCCTCTGGAGGAGAAGAGG - Intergenic
957485281 3:80853093-80853115 CTGATTCTCTAGAGGAGAAAAGG + Intergenic
958434396 3:94079984-94080006 GTGATCCTTTGGAGGAGAAGAGG + Intronic
958618575 3:96527747-96527769 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
959091688 3:101910497-101910519 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
959092946 3:101924100-101924122 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
959292015 3:104486031-104486053 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
959428559 3:106223444-106223466 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
959479482 3:106853968-106853990 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
959724465 3:109528247-109528269 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
959777966 3:110191962-110191984 ATAAGGCTCTGGAAGAGAAGGGG + Intergenic
959815927 3:110672645-110672667 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
959881086 3:111446158-111446180 GTGATCCTTTGGAGGAGAAGAGG + Intronic
960065497 3:113367668-113367690 GTGATCCTTTGGAGGAGAAGAGG - Intronic
960226788 3:115178666-115178688 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
960508194 3:118517829-118517851 GTGATTCTTTTGAGGAGAAGCGG - Intergenic
960703254 3:120457828-120457850 ATGATACTCTAGAGGGAAGGTGG - Intergenic
960776633 3:121263405-121263427 GTGATGATTTAGAGGAGAAGAGG - Intronic
960911354 3:122652113-122652135 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
961310709 3:125997636-125997658 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
961983424 3:131105078-131105100 ATGCTGCTCTCATGGAGAAGAGG - Intronic
962137031 3:132746211-132746233 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
962180979 3:133206355-133206377 GTGATCCTTTGGAGGAGAAGAGG + Intronic
962341365 3:134587249-134587271 CTGATCCTTTGGAGGAGAAGAGG + Intergenic
962366695 3:134791382-134791404 GAGATGCTCTAGGGGAAAAGAGG + Intronic
962512465 3:136115333-136115355 GTGATCCTTTGGAGGAGAAGAGG - Intronic
962513582 3:136127100-136127122 GTGATCCTTTGGAGGAGAAGAGG - Intronic
962602705 3:137006826-137006848 GTGATCCTTTGGAGGAGAAGAGG + Intronic
962642241 3:137399876-137399898 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
962656078 3:137544782-137544804 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
962666169 3:137655283-137655305 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
962675277 3:137751782-137751804 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
963013849 3:140802340-140802362 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
963898795 3:150713231-150713253 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
963976437 3:151484888-151484910 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
964010498 3:151886228-151886250 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
964049358 3:152372351-152372373 ATGATCCCTTGGAGGAGAAGAGG + Intronic
964391138 3:156199874-156199896 GTGATCCTTTGGAGGAGAAGAGG + Intronic
964648965 3:158990641-158990663 GTGATCCTTTGGAGGAGAAGAGG + Intronic
964904958 3:161708152-161708174 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
964947829 3:162247719-162247741 GTGTTGCTTTGGAGGAGAAGAGG - Intergenic
965017226 3:163173711-163173733 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
965090954 3:164162472-164162494 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
965221503 3:165932182-165932204 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
965293065 3:166908949-166908971 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
965618610 3:170620706-170620728 GTGATCCTTTGGAGGAGAAGAGG + Intronic
965654920 3:170974351-170974373 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
965880588 3:173383241-173383263 GTGATCCTTTAAAGGAGAAGAGG - Intergenic
966477672 3:180368439-180368461 GTGATCCTTTAGAGGAGAAGAGG - Intergenic
966493849 3:180557388-180557410 GTGATCCTTCAGAGGAGAAGAGG - Intergenic
966637789 3:182155759-182155781 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
966690056 3:182732487-182732509 AGTATGCTTTAGGGGAGAAGGGG + Intergenic
967419446 3:189258056-189258078 GTGATCCTTTGGAGGAGAAGAGG + Intronic
967562541 3:190934075-190934097 GTGATCCTCTGGAGAAGAAGAGG + Intergenic
967638730 3:191835536-191835558 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1202745085 3_GL000221v1_random:93197-93219 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
968828971 4:2922191-2922213 GTGATCCTTTGGAGGAGAAGAGG + Intronic
968860537 4:3165966-3165988 GTGATCCTTTGGAGGAGAAGAGG + Intronic
969909070 4:10427166-10427188 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
970304800 4:14719815-14719837 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
970412177 4:15818943-15818965 AAGATCATCTGGAGGAGAAGAGG - Intronic
970655281 4:18224366-18224388 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
970727300 4:19061229-19061251 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
970775537 4:19669638-19669660 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
971429932 4:26555567-26555589 GTGATCCTTTTGAGGAGAAGAGG + Intergenic
971467328 4:26977465-26977487 ATTAGACTCTTGAGGAGAAGGGG + Intronic
971516758 4:27496897-27496919 ATAATCATCTGGAGGAGAAGAGG - Intergenic
971679159 4:29674231-29674253 GTGATCCTTTAGAAGAGAAGAGG - Intergenic
971698004 4:29930727-29930749 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
971943087 4:33240690-33240712 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
972255755 4:37353901-37353923 GTGATCCTTTGGAGGAGAAGAGG + Intronic
972261158 4:37409093-37409115 GTGATCCTTTGGAGGAGAAGAGG - Intronic
972500536 4:39674082-39674104 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
972755687 4:42043163-42043185 GTGATCCTTTGGAGGAGAAGAGG - Intronic
973111808 4:46405759-46405781 GAGATCCTCTGGAGGAGAAGAGG - Intronic
973341742 4:49012528-49012550 GTGATCCTTTGGAGGAGAAGAGG + Intronic
973562763 4:52152585-52152607 GTGATCCTTTACAGGAGAAGAGG - Intergenic
973599076 4:52522957-52522979 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
973654429 4:53031363-53031385 GTGATCCTTTAGAGGAGAAGAGG - Intronic
973715099 4:53668869-53668891 GTGATCCTTTGGAGGAGAAGAGG + Intronic
974106117 4:57471947-57471969 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
974251648 4:59393568-59393590 GTAATGCTTTGGAGGAGAAGAGG + Intergenic
974263844 4:59559630-59559652 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
974306979 4:60155456-60155478 ATGATCCTTTTGAGGAGAAAAGG + Intergenic
974307382 4:60158374-60158396 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
974326191 4:60418421-60418443 GTGATCCTCTGGAGAAGAAGAGG + Intergenic
974491507 4:62570997-62571019 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
974654429 4:64800562-64800584 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
974741491 4:66013560-66013582 ATGATCATTTGGAGGAGAAGAGG + Intergenic
974814078 4:66982825-66982847 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
975291281 4:72680334-72680356 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
975305777 4:72847300-72847322 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
975307838 4:72868956-72868978 GTGATTCTTTGGAGGAGAAGAGG - Intergenic
975364868 4:73517887-73517909 ATGATCCTTTGAAGGAGAAGAGG + Intergenic
975466218 4:74713013-74713035 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
975524366 4:75332390-75332412 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
975744535 4:77463649-77463671 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
975764806 4:77655798-77655820 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
976006919 4:80440643-80440665 GTGATTCTTTAGAGGAGAAGAGG - Intronic
976167733 4:82272834-82272856 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
976363177 4:84203701-84203723 GTGATGTTTTGGAGGAGAAGAGG - Intergenic
976438423 4:85044735-85044757 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
976506374 4:85852505-85852527 GTGATCCTTTGGAGGAGAAGAGG + Intronic
976534220 4:86192829-86192851 GTGATCCTTTGGAGGAGAAGAGG + Intronic
976655799 4:87488151-87488173 GTGATCCTTTGGAGGAGAAGAGG + Intronic
976669625 4:87637254-87637276 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
976716062 4:88123247-88123269 GTGATCCTTTGGAGGAGAAGAGG - Intronic
976807299 4:89062827-89062849 GTGATCATCTGGAGGAGAAGAGG + Intronic
976852766 4:89567640-89567662 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
977154601 4:93556194-93556216 GTGATCCTTTGGAGGAGAAGAGG - Intronic
977326374 4:95579843-95579865 GTGATCCTATAGGGGAGAAGAGG + Intergenic
977671514 4:99700158-99700180 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
977793051 4:101129832-101129854 GTGATCCTTTGGAGGAGAAGAGG - Intronic
978055033 4:104253028-104253050 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
978108398 4:104931645-104931667 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
978185940 4:105857503-105857525 GTGATCCTTTGGAGGAGAAGAGG + Intronic
978269769 4:106875149-106875171 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
978278206 4:106977792-106977814 GTGATCCTTTGGAGGAGAAGAGG + Intronic
978464639 4:108995052-108995074 GTGATCCTTTGGAGGAGAAGAGG - Intronic
978494124 4:109340679-109340701 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
978588013 4:110293760-110293782 CTGATGGACCAGAGGAGAAGAGG - Intergenic
978601290 4:110431226-110431248 GTGATCCTTTGGAGGAGAAGAGG + Intronic
978929042 4:114288112-114288134 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
979012447 4:115388335-115388357 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
979310620 4:119198745-119198767 GTGATGCTTTGGAGGAGAAGAGG - Intronic
979462584 4:121001062-121001084 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
979554852 4:122033724-122033746 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
979581491 4:122365885-122365907 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
979659671 4:123238770-123238792 GTGATCCTTTGGAGGAGAAGAGG - Intronic
979705405 4:123714126-123714148 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
979730051 4:124013440-124013462 GTGATCCTTTCGAGGAGAAGAGG + Intergenic
980330268 4:131402637-131402659 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
980708199 4:136526956-136526978 AAGATGCTTTAGGGGACAAGTGG - Intergenic
980769442 4:137351967-137351989 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
980861768 4:138507547-138507569 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981133865 4:141188934-141188956 ATGATCCTTTGGAGGAAAAGAGG + Intronic
981273298 4:142868799-142868821 GTGTTCCTCTGGAGGAGAAGAGG - Intergenic
981395972 4:144249543-144249565 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981411380 4:144436017-144436039 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
981479919 4:145228132-145228154 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981481345 4:145242548-145242570 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981553618 4:145967458-145967480 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981629832 4:146805321-146805343 ATGATCCTTTGGAAGAGAAGAGG - Intronic
981656024 4:147113034-147113056 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
981662631 4:147184953-147184975 ATGATCCTCTGGATGAGAAGAGG - Intergenic
981671671 4:147293554-147293576 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
981787851 4:148501945-148501967 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981794830 4:148584654-148584676 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
981846636 4:149176928-149176950 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
981885461 4:149667514-149667536 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
982060147 4:151597081-151597103 GTGATCCTTTGGAGGAGAAGAGG + Intronic
982298831 4:153858783-153858805 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
982638458 4:157926701-157926723 GTGTTCCTCTGGAGGAGAAGAGG + Intergenic
982852830 4:160341533-160341555 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
982909098 4:161117303-161117325 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
983543425 4:168936368-168936390 GTGATCCTTTGGAGGAGAAGAGG - Intronic
983596194 4:169471177-169471199 GTGATACTTTGGAGGAGAAGAGG + Intronic
983602605 4:169548027-169548049 GTGATCCTTTGGAGGAGAAGAGG + Intronic
984008958 4:174347664-174347686 GTGATCCTCTGGAGGAGAAGAGG + Intergenic
984493789 4:180469472-180469494 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
984525927 4:180859788-180859810 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
984618765 4:181928114-181928136 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
985193891 4:187407484-187407506 ATGATCTTTTGGAGGAGAAGAGG + Intergenic
985204597 4:187521564-187521586 ATGATACTTTGGAAGAGAAGAGG - Intergenic
1202756692 4_GL000008v2_random:70018-70040 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
986005888 5:3668977-3668999 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
986110484 5:4710735-4710757 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
986303844 5:6500953-6500975 ATAATGGTCAAGAGAAGAAGTGG + Intergenic
986322957 5:6648819-6648841 GTGATCCTTTGGAGGAGAAGAGG + Intronic
986378711 5:7161870-7161892 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
986656264 5:10016072-10016094 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
987656652 5:20815696-20815718 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
988254902 5:28809073-28809095 ATGGTGCTCGTGAGGACAAGCGG + Intergenic
988381191 5:30498884-30498906 ATGATCCTTTGGAGGAGAAGAGG + Intergenic
988402237 5:30776527-30776549 GTGATCCTTTGGAGGAGAAGTGG - Intergenic
988485487 5:31665194-31665216 ATCAAGCTCAGGAGGAGAAGAGG - Intronic
988627904 5:32897933-32897955 TTGATGCTTTGGAGGTGAAGAGG + Intergenic
988719332 5:33860097-33860119 GTGATCCTTTGGAGGAGAAGAGG - Intronic
988766899 5:34388248-34388270 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
989194288 5:38700719-38700741 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
989390625 5:40896443-40896465 GCGATCCTCTAGAGGAGAAGAGG - Intergenic
989516908 5:42354252-42354274 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
989618926 5:43366220-43366242 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
990098978 5:52157779-52157801 GTGATCCTTTGGAGGAGAAGTGG - Intergenic
990164218 5:52976963-52976985 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
990224163 5:53630937-53630959 ATGATCCTTTGGAGGAGAAGAGG + Intronic
990897472 5:60714969-60714991 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
991046656 5:62230328-62230350 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
991110618 5:62895920-62895942 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
991128257 5:63091383-63091405 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
991161500 5:63508343-63508365 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
991223694 5:64244176-64244198 GTGATCCTTTGGAGGAGAAGAGG - Intronic
991242454 5:64475142-64475164 GTGATCCTCTGGAGGAGAGGAGG - Intergenic
991283114 5:64939163-64939185 GTGATCCTTTGGAGGAGAAGAGG + Intronic
991417589 5:66408114-66408136 CTGAAGCTCTAGAGGAGACTGGG - Intergenic
991934876 5:71791154-71791176 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
992077992 5:73208158-73208180 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
992254748 5:74910823-74910845 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
992292317 5:75292311-75292333 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
992505947 5:77388132-77388154 GTGATCCTTTGGAGGAGAAGAGG + Intronic
992732925 5:79690390-79690412 ATCCTGCGCTAGAGGAGAAGGGG + Intronic
992740498 5:79769352-79769374 ATGATCCTTTAAAGGAGAAGAGG + Intronic
992977587 5:82137267-82137289 GTGATCCTTGAGAGGAGAAGAGG + Intronic
993044000 5:82847097-82847119 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
993145134 5:84085233-84085255 GTGATCATTTAGAGGAGAAGAGG + Intronic
993255610 5:85587280-85587302 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
993265603 5:85722393-85722415 ATGATCCTTTGGAGGAAAAGAGG - Intergenic
993438194 5:87924019-87924041 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
993513304 5:88798696-88798718 GTGATCCTTTGGAGGAGAAGAGG + Intronic
993656229 5:90581311-90581333 GTGATCCTTTGGAGGAGAAGAGG + Intronic
993757507 5:91750269-91750291 GTGATCCTTTAGAGGAGAAGAGG + Intergenic
993891807 5:93483534-93483556 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
993895102 5:93523940-93523962 GTGATCCTTTGGAGGAGAAGTGG - Intergenic
993947901 5:94137508-94137530 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
994005047 5:94828014-94828036 GTGATCCTTTGGAGGAGAAGAGG + Intronic
994015158 5:94956351-94956373 GTGATCCTTTGGAGGAGAAGAGG - Intronic
994039772 5:95245261-95245283 GTGATCCTTTGGAGGAGAAGAGG - Intronic
994233411 5:97335454-97335476 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
994265044 5:97705129-97705151 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
994437941 5:99762852-99762874 GTGATCCTTTTGAGGAGAAGAGG + Intergenic
994510748 5:100700622-100700644 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
994602675 5:101926667-101926689 AAGATTCTAAAGAGGAGAAGTGG - Intergenic
994609649 5:102019654-102019676 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
994642082 5:102422208-102422230 GTGATCCTTTGGAGGAGAAGAGG - Intronic
995093799 5:108212387-108212409 GTGATCCTTTGGAGGAGAAGAGG + Intronic
995111969 5:108438267-108438289 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
995131363 5:108633666-108633688 ATGATTCCCCAGAGAAGAAGGGG + Intergenic
995136452 5:108685171-108685193 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
995326095 5:110892110-110892132 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
995355401 5:111231485-111231507 ATGATTCTCAAGAGGAGAGAGGG - Intronic
995398579 5:111716248-111716270 GTGATCCTTTGGAGGAGAAGAGG + Intronic
995480493 5:112587397-112587419 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
995620737 5:114022332-114022354 GTGATCCTTTAGAGGAGAAGAGG - Intergenic
996130065 5:119770617-119770639 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
996270799 5:121602493-121602515 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
996270912 5:121603237-121603259 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
996681094 5:126228802-126228824 AGTATCCTCTAGAGGGGAAGTGG - Intergenic
996782084 5:127198245-127198267 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
996798062 5:127372627-127372649 TTGATAGTCTAGAGGAGAACTGG + Intronic
997240191 5:132301193-132301215 ATGATGCTCCATGGGAGAAGAGG - Intronic
997245872 5:132348807-132348829 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
997646809 5:135487434-135487456 AGGCTGCTCCAGGGGAGAAGTGG - Intergenic
997809404 5:136953106-136953128 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
998520442 5:142795365-142795387 AGCATGCTCTAGGGAAGAAGAGG + Intronic
998691494 5:144593799-144593821 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
998768335 5:145513072-145513094 GTGATCCTTTGGAGGAGAAGAGG - Intronic
998972653 5:147610240-147610262 TTGATCCTTTGGAGGAGAAGAGG + Intronic
999029945 5:148280340-148280362 GTGATCCTTTGGAGGAGAAGAGG + Intronic
999489715 5:152038393-152038415 GTGATCCTATGGAGGAGAAGAGG + Intergenic
999559845 5:152788653-152788675 GCGATCCTTTAGAGGAGAAGAGG - Intergenic
999688432 5:154123243-154123265 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1000091378 5:157932235-157932257 ATGTTAGTTTAGAGGAGAAGTGG + Intergenic
1000194641 5:158946239-158946261 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1000214396 5:159140628-159140650 GTGATCCTTTAGAGGAGAAGTGG - Intergenic
1000406603 5:160894132-160894154 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1000590155 5:163147818-163147840 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1000597967 5:163237249-163237271 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1000719994 5:164694026-164694048 GTGATCATCTGGAGGAGAAGCGG - Intergenic
1000798254 5:165692465-165692487 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1001542098 5:172546729-172546751 ATGCTGGTCCAGAGGAGGAGGGG + Intergenic
1002673656 5:180890784-180890806 GTGATGCTTTGGAGGAGAAGAGG - Intergenic
1002734683 5:181376616-181376638 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1002749850 6:97504-97526 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1002944970 6:1751969-1751991 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1002996237 6:2287613-2287635 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1003987663 6:11452892-11452914 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1004028114 6:11838281-11838303 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004210586 6:13638282-13638304 ATGATATTCAAGAGGAGTAGTGG + Intronic
1004593337 6:17074521-17074543 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1005558242 6:27009501-27009523 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1005780911 6:29191071-29191093 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1005883647 6:30078291-30078313 GTGAAGCTCTGGAGGAGCAGGGG - Intergenic
1005936085 6:30521892-30521914 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1006149757 6:31980639-31980661 CTGGCGCCCTAGAGGAGAAGTGG - Exonic
1006156057 6:32013377-32013399 CTGGCGCCCTAGAGGAGAAGTGG - Intergenic
1007365466 6:41388823-41388845 GTGATATTCAAGAGGAGAAGGGG - Intergenic
1007851910 6:44811269-44811291 ATGATGCTCAAGATTAGAAGGGG + Intronic
1008082766 6:47210832-47210854 ATGATCATTTGGAGGAGAAGAGG - Intergenic
1008094848 6:47328918-47328940 TTGATCCTTTGGAGGAGAAGAGG - Intergenic
1008298590 6:49806580-49806602 GTGATCATCTGGAGGAGAAGAGG - Intergenic
1008421551 6:51306329-51306351 ATGATGCTGTAGAGGAGGAGAGG + Intergenic
1008436757 6:51485425-51485447 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
1008633268 6:53383815-53383837 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1008785231 6:55159424-55159446 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1008864109 6:56189052-56189074 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1008865544 6:56205071-56205093 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1008963338 6:57288888-57288910 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1009290219 6:61870942-61870964 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1009384756 6:63075320-63075342 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1009455383 6:63849761-63849783 TTGATCCTTTGGAGGAGAAGAGG - Intronic
1009679601 6:66874822-66874844 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1009794944 6:68455344-68455366 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1009880623 6:69561548-69561570 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1009988020 6:70805558-70805580 GTGATGCTTTGGAAGAGAAGAGG + Intronic
1010006360 6:70999079-70999101 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1010282136 6:74034734-74034756 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1010297925 6:74222355-74222377 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1010364348 6:75031917-75031939 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1010475573 6:76282877-76282899 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1010575045 6:77519510-77519532 ATAATCCTTTGGAGGAGAAGAGG - Intergenic
1010594709 6:77749205-77749227 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1010670163 6:78677066-78677088 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1010822557 6:80432734-80432756 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1010838001 6:80613195-80613217 GTGATCCTTTAGAGGAAAAGAGG - Intergenic
1011020573 6:82808548-82808570 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1011086608 6:83547553-83547575 GTGATGCTTTGGAGGAGAAGAGG - Intergenic
1011120212 6:83943551-83943573 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1011161099 6:84391134-84391156 ATGATGCTCTAGTGGAGTTTTGG + Intergenic
1011174226 6:84541902-84541924 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1011219981 6:85044085-85044107 ATGATACTCTAGAAGGGAATAGG - Intergenic
1011235464 6:85212197-85212219 GTGATCCTTTAGAGGAGAAAAGG + Intergenic
1011288707 6:85752723-85752745 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1011304111 6:85908071-85908093 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1011332634 6:86227398-86227420 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1011336881 6:86271577-86271599 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1011578333 6:88828477-88828499 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1011766376 6:90624193-90624215 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1011816005 6:91191290-91191312 GTGATCCTCTGGAGGAGAAGAGG + Intergenic
1011848095 6:91591048-91591070 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1012127810 6:95453332-95453354 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1012149062 6:95722577-95722599 ATCATACTCAAGAGGAGAAATGG - Intergenic
1012207270 6:96477159-96477181 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1012484281 6:99703204-99703226 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1012498030 6:99856219-99856241 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1012871006 6:104672153-104672175 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1013390374 6:109680038-109680060 GTGATCCTGTGGAGGAGAAGAGG - Intronic
1013453125 6:110304253-110304275 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1013464602 6:110406744-110406766 GTGATGTTGTAGAGGTGAAGTGG - Intronic
1013926554 6:115480117-115480139 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1013939718 6:115646249-115646271 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1013957038 6:115853395-115853417 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1013964328 6:115936410-115936432 GTGATCCTTTGGAGGAGAAGAGG - Exonic
1014058375 6:117043141-117043163 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1014070497 6:117175959-117175981 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1014084896 6:117330928-117330950 GTGATCATTTAGAGGAGAAGAGG - Intronic
1014098023 6:117481713-117481735 ATGATCCTCTTGAGGAGTTGCGG - Intronic
1014352548 6:120362842-120362864 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1014386953 6:120815244-120815266 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1014430920 6:121369315-121369337 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1014466454 6:121761580-121761602 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1014569160 6:122987284-122987306 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1014589348 6:123244180-123244202 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1014886701 6:126790705-126790727 ATGAACCTGTAGAGGAGAACAGG + Intergenic
1015046179 6:128779278-128779300 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1015133133 6:129836505-129836527 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1015211439 6:130702702-130702724 CTGATCCTTTGGAGGAGAAGAGG - Intergenic
1015471978 6:133615672-133615694 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1015585926 6:134776314-134776336 GTTATCCTTTAGAGGAGAAGAGG - Intergenic
1015623268 6:135155392-135155414 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
1015802196 6:137071218-137071240 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1015883156 6:137890441-137890463 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1015914238 6:138199401-138199423 TTGATGCTCTGGGTGAGAAGAGG - Intronic
1015967610 6:138710959-138710981 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1016102164 6:140115809-140115831 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1016338428 6:143034433-143034455 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1016412839 6:143801754-143801776 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1016523783 6:144976772-144976794 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1016855899 6:148670654-148670676 TTGATCCTTTGGAGGAGAAGAGG + Intergenic
1017197290 6:151715890-151715912 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1017279738 6:152610080-152610102 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1017302985 6:152883727-152883749 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1017322763 6:153112019-153112041 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1017524638 6:155231767-155231789 ATGATGCTCTTGAGTGGAGGTGG - Intronic
1017571541 6:155749676-155749698 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1017594454 6:156013817-156013839 AAGATGCTCTAGAGGTAAATGGG + Intergenic
1018213220 6:161502480-161502502 ATGTTGCTTCAGAAGAGAAGGGG - Intronic
1018304692 6:162442839-162442861 ATGCTGCGCTAGAGGAGGTGTGG - Intronic
1018985310 6:168631928-168631950 ATGATGATCTGGAGGAGGACAGG + Intronic
1019071782 6:169352922-169352944 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1019238936 6:170648936-170648958 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1020333531 7:7043221-7043243 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1020338865 7:7088336-7088358 GTGATCCTTTAGAGAAGAAGAGG + Intergenic
1020367116 7:7393031-7393053 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1020391280 7:7661364-7661386 ATGATCCTTTGGAGGAGAAGGGG + Intronic
1020503916 7:8959349-8959371 ATGAAGCTATAGATGAGCAGGGG - Intergenic
1020519465 7:9168422-9168444 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1020609181 7:10373621-10373643 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1020629858 7:10626458-10626480 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1020636090 7:10696949-10696971 GTGATCCTTTAGAGGAGAAGAGG - Intergenic
1020716171 7:11676351-11676373 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1021014789 7:15518751-15518773 GTGATACTTTGGAGGAGAAGAGG - Intronic
1021065193 7:16164563-16164585 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1021307283 7:19046820-19046842 GTGATCCTTTGGAGGAGAAGGGG - Intronic
1021347559 7:19547304-19547326 ATGATCCTTTGGAGAAGAAGAGG + Intergenic
1021502180 7:21344337-21344359 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1021556866 7:21928390-21928412 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1022058722 7:26769511-26769533 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1022869253 7:34458294-34458316 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1022884563 7:34629191-34629213 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1023233619 7:38060544-38060566 AAGATTCTCTAGGAGAGAAGGGG - Intergenic
1023691835 7:42797211-42797233 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1023901416 7:44483543-44483565 ATGGAGCTCTGGATGAGAAGGGG - Intronic
1024372791 7:48606269-48606291 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1024502825 7:50131010-50131032 ATGAGGCTTTAGCAGAGAAGTGG + Intronic
1024590097 7:50873444-50873466 GTGATCATTTAGAGGAGAAGAGG - Intergenic
1024817392 7:53287383-53287405 GTGATACTTTAGAGGAGAAGGGG + Intergenic
1024950395 7:54855077-54855099 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1024998388 7:55293977-55293999 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1025637811 7:63339174-63339196 GTGATCATTTAGAGGAGAAGAGG + Intergenic
1025644886 7:63408925-63408947 GTGATCATTTAGAGGAGAAGAGG - Intergenic
1025720924 7:64012329-64012351 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1025788006 7:64660972-64660994 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1026488272 7:70839259-70839281 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1027445943 7:78273991-78274013 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1027449794 7:78318057-78318079 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1027583005 7:80021210-80021232 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1027778088 7:82491800-82491822 ATGATCCTTTGGAGGGGAAGAGG + Intergenic
1027864443 7:83628840-83628862 GTGATCCTTTGGAGGAGAAGGGG + Intronic
1028078642 7:86547314-86547336 GTGATCCTTTAGGGGAGAAGGGG + Intergenic
1028114593 7:86982771-86982793 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1028142264 7:87287471-87287493 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1028145764 7:87318573-87318595 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1028412914 7:90550575-90550597 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1028627847 7:92897817-92897839 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1028691954 7:93663079-93663101 ACGATCCTTTGGAGGAGAAGGGG + Intronic
1028801276 7:94969201-94969223 ATGATCCTTTGGAGGAGAAGAGG + Intronic
1029854968 7:103505672-103505694 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1030258061 7:107533253-107533275 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1030325723 7:108216970-108216992 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1030331629 7:108277793-108277815 ATGTTCCTTTGGAGGAGAAGAGG + Intronic
1030736411 7:113054099-113054121 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1030770989 7:113474981-113475003 GTGACCCTTTAGAGGAGAAGAGG + Intergenic
1030936814 7:115594667-115594689 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1031031924 7:116744123-116744145 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1031173210 7:118317372-118317394 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1031391969 7:121226035-121226057 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1031434176 7:121712518-121712540 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1031699147 7:124901614-124901636 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1031711126 7:125047384-125047406 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1031764925 7:125766032-125766054 ATAATGCTTTTGAGGAGAAGGGG - Intergenic
1032469369 7:132167155-132167177 ATAATGGCCTAGAGGAGAAATGG + Intronic
1032594114 7:133222430-133222452 ATGATTCTCAAGAGGAGAAAGGG + Intergenic
1033133335 7:138764203-138764225 ATGATGATCTCGAAGGGAAGAGG + Intronic
1033525742 7:142211276-142211298 GTGATCCTTTGGAGGAGAAGGGG - Intronic
1033679468 7:143579953-143579975 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1033692368 7:143749490-143749512 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1034314615 7:150118171-150118193 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1034360936 7:150497189-150497211 GTGATTCTTTGGAGGAGAAGAGG - Intergenic
1034370653 7:150593785-150593807 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1034792285 7:153982598-153982620 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1035508833 8:157673-157695 GTGATACTTTGGAGGAGAAGAGG - Intergenic
1035639394 8:1172930-1172952 GTGATGCTTTGGAGGAGGAGAGG + Intergenic
1035998191 8:4573174-4573196 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1036644942 8:10607185-10607207 AGGATGCTCTGGAGGAGGAAGGG + Exonic
1037026954 8:14050727-14050749 ATGTTGCTCTAAAACAGAAGTGG - Intergenic
1037249903 8:16879356-16879378 ATGTTCCTTTAGAGGAGAAGAGG - Intergenic
1037258156 8:16978879-16978901 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1037285353 8:17293512-17293534 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1037398438 8:18467972-18467994 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1038083183 8:24163586-24163608 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1038936313 8:32256242-32256264 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1039170337 8:34738458-34738480 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1039624235 8:39031705-39031727 GTGATCCTTTGGAGGAGAAGGGG + Intronic
1039676668 8:39675680-39675702 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1040473154 8:47753044-47753066 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1040780026 8:51096055-51096077 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1040919023 8:52596472-52596494 ATGATGACTTAGAGTAGAAGGGG - Intergenic
1041221642 8:55657216-55657238 ACGATCCTTTGGAGGAGAAGAGG - Intergenic
1041349969 8:56938364-56938386 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1041459611 8:58097600-58097622 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1041574845 8:59381903-59381925 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1041583840 8:59494180-59494202 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1041755696 8:61311005-61311027 ATGAGGTACTAGAGAAGAAGAGG + Intronic
1041836751 8:62224509-62224531 TTGATCCTTTGGAGGAGAAGAGG - Intergenic
1041900509 8:62977767-62977789 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1041909962 8:63078271-63078293 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1042195712 8:66229601-66229623 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1042308613 8:67357996-67358018 ATGATCCTTTGGAGGAAAAGAGG + Intergenic
1042327045 8:67540055-67540077 GTGATTCTTTGGAGGAGAAGAGG + Intronic
1042541195 8:69908341-69908363 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1042640922 8:70933118-70933140 AGGATACTGTAAAGGAGAAGTGG + Intergenic
1043304519 8:78777981-78778003 ATGTAGCTCTAGAGGAGATTTGG - Intronic
1043605033 8:81990142-81990164 GTGATCCTTTGGAGGAGAAGGGG + Intergenic
1043748843 8:83909643-83909665 GTGATTCTTTGGAGGAGAAGAGG - Intergenic
1043938780 8:86173533-86173555 GTGATCCTTCAGAGGAGAAGAGG + Intergenic
1044292649 8:90491063-90491085 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1044385694 8:91585696-91585718 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1044521505 8:93204759-93204781 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1044595090 8:93952018-93952040 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1044808967 8:96038163-96038185 GTGATCCTTTAGTGGAGAAGAGG + Intergenic
1044961131 8:97531262-97531284 GTGATCCTATAGAGGAGAAGAGG - Intergenic
1045007181 8:97926739-97926761 AAAATGTTCTAGAGGAGATGTGG - Intronic
1045185050 8:99829651-99829673 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1045187439 8:99853436-99853458 CTGGCGCTCTAGAGGAGAAAGGG - Exonic
1045705323 8:104916067-104916089 GTGATCATCTGGAGGAGAAGAGG + Intronic
1045783804 8:105898060-105898082 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1045921378 8:107534089-107534111 ATGATGATCTAGAGAACAAATGG - Intergenic
1045973463 8:108104895-108104917 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1045974977 8:108122086-108122108 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1046602020 8:116327589-116327611 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1046608018 8:116391797-116391819 GTGATCCTTTTGAGGAGAAGAGG - Intergenic
1046947352 8:119987086-119987108 GTGATCCTTTGGAGGAGAAGGGG + Intronic
1047369450 8:124244600-124244622 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1047513219 8:125531235-125531257 AAGATGCTCTGGTGGAGATGGGG + Intergenic
1047604240 8:126458327-126458349 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1048332404 8:133479741-133479763 AGGATGCCCCAGAGGAGAGGAGG - Intronic
1048398122 8:134034426-134034448 ATGAAGCTCTGGAGGGGGAGGGG + Intergenic
1048467166 8:134675041-134675063 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1048521150 8:135156670-135156692 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1048543981 8:135368781-135368803 ATGCAGCTCAGGAGGAGAAGTGG - Intergenic
1050049848 9:1588437-1588459 ATGTTCCTTTGGAGGAGAAGAGG + Intergenic
1050239785 9:3623388-3623410 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1050300374 9:4252665-4252687 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1050320807 9:4449931-4449953 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1050450957 9:5780550-5780572 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1050492508 9:6203599-6203621 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1050637528 9:7627569-7627591 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1050700070 9:8329085-8329107 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1051230593 9:14950814-14950836 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1051238476 9:15026273-15026295 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1051489545 9:17646430-17646452 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1051670341 9:19504141-19504163 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1051695694 9:19766353-19766375 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1051814434 9:21088299-21088321 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1051863271 9:21650905-21650927 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1052096465 9:24390533-24390555 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1052329514 9:27252574-27252596 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1052336260 9:27323663-27323685 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1052366073 9:27613985-27614007 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1052667879 9:31518442-31518464 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1052752865 9:32509672-32509694 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1052770597 9:32685223-32685245 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1052888084 9:33668421-33668443 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1053822085 9:41978397-41978419 AAGATGCTCCAGAGGAGCCGAGG + Intronic
1054608489 9:67209016-67209038 AAGATGCTCCAGAGGAGCCGAGG - Intergenic
1054719654 9:68592233-68592255 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1054890085 9:70241387-70241409 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1055061552 9:72073588-72073610 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1055125580 9:72715816-72715838 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1055239355 9:74164710-74164732 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1055390826 9:75820804-75820826 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1055537751 9:77267219-77267241 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1056176663 9:84043133-84043155 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1056385023 9:86089811-86089833 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1056997047 9:91472759-91472781 ATGATCCTTTGGAGGAGAAGAGG + Intergenic
1057697888 9:97340216-97340238 GTGATCCTTTGGAGGAGAAGGGG + Intronic
1058012102 9:99989629-99989651 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1058093154 9:100828803-100828825 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1058182641 9:101816601-101816623 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1058408588 9:104704546-104704568 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1058465832 9:105226316-105226338 GTGATGCTATAGAAGAAAAGGGG + Intergenic
1059136063 9:111807598-111807620 ATGATCATTTGGAGGAGAAGAGG + Intergenic
1059421762 9:114196621-114196643 CTGATGCTCTGCAGGGGAAGGGG + Intronic
1059495687 9:114707334-114707356 ATGATGTTTCAGAGGAGATGAGG - Intergenic
1059513483 9:114870768-114870790 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1059954712 9:119503263-119503285 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1060326166 9:122618047-122618069 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1061952051 9:133942096-133942118 ACGGTGCTCTAGAGGAAAACCGG + Intronic
1062759141 9:138329226-138329248 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1203688291 Un_GL000214v1:17078-17100 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
1203754323 Un_GL000218v1:110641-110663 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1203713710 Un_KI270742v1:123147-123169 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1203537488 Un_KI270743v1:54874-54896 GTGATCTTCTGGAGGAGAAGAGG - Intergenic
1203647984 Un_KI270751v1:86975-86997 GTGATCTTCTGGAGGAGAAGAGG + Intergenic
1186599674 X:11023851-11023873 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1186773190 X:12838410-12838432 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1186929259 X:14370280-14370302 TTGATCCTTTGGAGGAGAAGAGG - Intergenic
1187595902 X:20772246-20772268 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1187784438 X:22867749-22867771 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1187829062 X:23362683-23362705 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1188129891 X:26418817-26418839 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1188201811 X:27300604-27300626 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1188296488 X:28456273-28456295 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1188664758 X:32805049-32805071 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1188707352 X:33352020-33352042 ATGATTATTTAGGGGAGAAGAGG + Intergenic
1188893168 X:35635429-35635451 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1188921803 X:35986663-35986685 GTGATACTTTGGAGGAGAAGAGG + Intronic
1188954472 X:36417916-36417938 ACGATCCTTTGGAGGAGAAGAGG + Intergenic
1189039642 X:37529511-37529533 GTGATTCTTTGGAGGAGAAGAGG + Intronic
1189189754 X:39089894-39089916 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1189210686 X:39279756-39279778 ATGATCCTTTGTAGGAGAAGAGG + Intergenic
1189574977 X:42342423-42342445 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1189590760 X:42508101-42508123 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1189618974 X:42815728-42815750 GTGATGCTTTGGAGGAGAAGAGG + Intergenic
1189936926 X:46079644-46079666 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1189937888 X:46088208-46088230 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1190420264 X:50223318-50223340 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1190472883 X:50800506-50800528 ATGATGCCCTAGAGGCTTAGAGG + Intronic
1190979617 X:55444311-55444333 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1191113824 X:56831654-56831676 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1191153368 X:57243832-57243854 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1191203980 X:57815473-57815495 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1191632069 X:63332126-63332148 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1191676745 X:63798837-63798859 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1191785122 X:64908677-64908699 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1191787864 X:64935857-64935879 GTGATCCTTTAGAGGAGAAGAGG - Intronic
1191793903 X:65000521-65000543 GTGATTCTTTGGAGGAGAAGAGG - Intronic
1191947882 X:66554953-66554975 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1192159910 X:68776749-68776771 CTGATCCTTTGGAGGAGAAGAGG - Intergenic
1192395993 X:70781401-70781423 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1192598679 X:72438430-72438452 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1192613021 X:72586515-72586537 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1192637052 X:72830180-72830202 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1192644662 X:72890634-72890656 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1192703061 X:73497091-73497113 GTGATCCTCTGGAGGAGAAGAGG + Intergenic
1192755706 X:74045655-74045677 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1192883512 X:75313223-75313245 GTGATACTTTGGAGGAGAAGAGG + Intergenic
1192964297 X:76160400-76160422 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1192992236 X:76472323-76472345 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193060035 X:77196514-77196536 GTAATCCTTTAGAGGAGAAGAGG + Intergenic
1193073936 X:77335039-77335061 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193075301 X:77348576-77348598 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193161240 X:78232134-78232156 GTGATTCTTTGGAGGAGAAGAGG + Intergenic
1193281411 X:79655491-79655513 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1193315959 X:80065596-80065618 GTGATCCTTTGGAGGAGAAGTGG + Intergenic
1193334766 X:80274816-80274838 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193350954 X:80463571-80463593 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193361585 X:80585928-80585950 GTGATCATTTAGAGGAGAAGAGG + Intergenic
1193394596 X:80968691-80968713 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193434086 X:81450352-81450374 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1193525172 X:82580399-82580421 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1193594973 X:83435055-83435077 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1193729223 X:85082146-85082168 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1193835377 X:86336660-86336682 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1193878857 X:86896942-86896964 GTGATCCTTTAGAGCAGAAGAGG - Intergenic
1194021379 X:88695613-88695635 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1194098695 X:89675205-89675227 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1194229061 X:91299611-91299633 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1194515214 X:94844243-94844265 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1194643265 X:96428629-96428651 GTGATCCTCTGGAGGAGAAGAGG + Intergenic
1194783012 X:98048409-98048431 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1194798266 X:98239890-98239912 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1194964125 X:100267914-100267936 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1195232884 X:102869237-102869259 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1195414349 X:104603388-104603410 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1195414930 X:104609906-104609928 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1195457256 X:105082886-105082908 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1195519124 X:105811493-105811515 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1195729146 X:107948506-107948528 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1195826300 X:109004430-109004452 TTGATGCTTTGGAGGAGAAGAGG - Intergenic
1195847854 X:109248066-109248088 GTGATCCTGTGGAGGAGAAGAGG + Intergenic
1195882270 X:109604474-109604496 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1195932754 X:110095736-110095758 ATGTTCCTTTGGAGGAGAAGAGG + Intronic
1195948319 X:110239135-110239157 GTGATCCTTTGGAGGAGAAGAGG - Intronic
1196094618 X:111785498-111785520 GTGATTCTTTGGAGGAGAAGAGG - Intronic
1196133522 X:112182269-112182291 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1196167364 X:112550750-112550772 GTGATACTTTGGAGGAGAAGAGG + Intergenic
1196307937 X:114126882-114126904 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1196631356 X:117943883-117943905 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1196853670 X:119962545-119962567 GTGTTCCTTTAGAGGAGAAGAGG - Intergenic
1196946473 X:120832112-120832134 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1197003966 X:121473937-121473959 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1197071157 X:122299640-122299662 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1197098215 X:122620901-122620923 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1197486301 X:127055862-127055884 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1197493768 X:127152817-127152839 ATATTGCTCTAGATGAAAAGAGG - Intergenic
1197516979 X:127444589-127444611 AAGATGCTGCAGAGCAGAAGTGG + Intergenic
1198002150 X:132450721-132450743 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1198085758 X:133280020-133280042 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1198595571 X:138231799-138231821 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1199012019 X:142769521-142769543 GTGATGCTTTGGAAGAGAAGAGG + Intergenic
1199276478 X:145949332-145949354 AGGCTGTTTTAGAGGAGAAGGGG - Intergenic
1199450011 X:147968509-147968531 GTGATCCTTTGGAGGAGAAGGGG - Intergenic
1199968417 X:152840359-152840381 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1200333353 X:155320647-155320669 GTGATACTTTGGAGGAGAAGAGG - Intronic
1200451718 Y:3336579-3336601 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1200761343 Y:7042023-7042045 ATGATGCACTGGGGGAGAAAAGG + Intronic
1200803441 Y:7407772-7407794 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1201182263 Y:11359882-11359904 ATGATCCTTTGGAGGAGAAGAGG - Intergenic
1201230912 Y:11863505-11863527 GTGATCCTTTGGAGGAGAAGAGG + Intergenic
1201371365 Y:13268582-13268604 GTGATCCTTTGGAGGAGAAGAGG + Intronic
1201493203 Y:14565105-14565127 GTGATCCTCTGGAGGAGGAGAGG - Intronic
1201498125 Y:14612345-14612367 ATGATCCTTTGGAAGAGAAGAGG + Intronic
1201519728 Y:14860075-14860097 GTGATCCTTTGGAGGAGAAGAGG - Intergenic
1201644586 Y:16215883-16215905 ATGATGTTATAGAGGAGATGGGG + Intergenic
1201658229 Y:16369438-16369460 ATGATGTTATAGAGGAGATGGGG - Intergenic
1201693003 Y:16789925-16789947 GTGATCCTTTGGAGGAGAAGAGG - Intergenic